Labshake search
Citations for Addgene :
1301 - 1350 of 2007 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 6-week-old Slc17a7Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1/5-CamKIIahChR2(H134R)-eYFP or AAV1/5-CamKIIa-eYFP (AAV5: from UNC GTC Vectore Core; AAV1: from Addgene) was injected bilaterally in mPFC under stereotaxic guidance at 2.2 mm anterior and 0.3 mm lateral to bregma and 1.6 mm ventral to the skull ...
-
bioRxiv - Microbiology 2021Quote: A 2933 bp in vitro DNA synthesized IRES-vpr mKO fragment was ordered from Genewiz (South Plainfield, NJ) using an IRES sequence from pTRIPZ-hDDX5/7 (Addgene Plasmid #71307) (64 ...
-
bioRxiv - Neuroscience 2022Quote: ... into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL, #114469-AAVrg, Addgene, MA, USA) into the HP ...
-
bioRxiv - Neuroscience 2022Quote: ... Following AAVs were used: AAVrg-CAG-FLEX-rc[Jaws-KGC-GFP-ER2] (titer >7×1012 vg/ml, viral prep #84445-AAVrg, Addgene, US,34) or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml ...
-
bioRxiv - Cell Biology 2021Quote: HEK-293T cells plated on polylysine-coated coverslips were transfected with cDNA (100 ng/40000 cells) coding for mitochondrial-targeted mCherry (mCherry-Mito-7, a gift from Michael Davidson (Addgene plasmid # 55102), (Olenych et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... CRISPR-mediated gene disruption was performed by identifying individual gRNA sequences with consistent enrichment in LDLlow cells in our previously reported CRISPR screens [7] and cloning these sequences into the BsmBI sites of pLentiCRISPRv2 (Addgene #52961, [43]) or into the BbsI sites of pX459 (Addgene #62988 ...
-
bioRxiv - Neuroscience 2023Quote: ... were secured in a stereotaxic frame and unilateral or bilateral injections of fluorogold or choleratoxin B subunit tracers dissolved in glycerol (FG 2% iontophoresis by 2 µA pulses with 2/2 s on/off duty cycle for 5 minutes and CTB 0.5% iontophoresis by 5 µA pulses with 2/2 s on/off duty cycle for 7-10 minutes) or retrograde pAAVrg-CAG-GFP (Addgene: 37825-AAVrg) or retrograde AAVrg-EF1a-mCherry-IRES-Flpo (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: Firefly and Renilla luciferase expression plasmids were cloned by standard methods starting with the pGL3 PUb-luc plasmid described previously (7) and pSLfa-PUb-MCS (Addgene plasmid # 52908). Transgenesis plasmids were generated using NEBuilder HiFi Assembly Master Mix (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Vectors for eukaryotic expression of Gs12-7 or Gs12-10 were constructed into Age I and BamH I sites of pLenti-Puro (Addgene plasmids #39481)58 following human codon optimization ...
-
bioRxiv - Bioengineering 2024Quote: ... mRFP was amplified from pDEST-12.5’RFP 14 by PCR using primers 7 and 8 listed in Supplementary Table 1 and cloned into the NheI-KpnI site of pEGFP-C2 (Addgene, #6083-1) using the In-Fusion® HD Cloning Kit (Takara Bio USA) ...
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids used in this work are listed in Supplementary Table 6 and are available from Addgene (identifiers listed in Supplementary Table 6).
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 µg psPAX2 and 3.6 µg pMD2G (gift from the Trono lab, Addgene #12259 and #12260) packaging plasmid using CalPhos Mammalian Transfection Kit (Takara) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ir21a-Gal80 was created by subcloning the Ir21a promoter region into pBPGAL80Uw-6 (Addgene plasmid # 26236) [28 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg pT3 EF1a-MYC (Addgene plasmid # 92046) and 1 μg CMV-SB10 (Addgene plasmid # 24551 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’-entry vector pENTR5’-ubi (ubiquitin promoter) (Addgene plasmid #27230 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µg VSV-G (pMD2.G, Addgene #12259) and 3.3 µg of plasmid of interest ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Glut2 in pX330S-5 (Plasmid #58781, Addgene). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg AAVS1-TALEN L plasmid (Addgene #59025), and 5mg donor plasmid (AAVS1 TREG EBdCas9 or AAVS1 TREG EBNCdCas9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of packaging plasmids psPAX2 (Addgene, #12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... pMDLg/pRRE (Addgene 658-5, 12259, 12251, 12253) to generate lentiviruses expressing ANDV or TULV N proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5-hSyn-DIO-EGFP (Addgene # 50457-AAV5) or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg packaging plasmid pUMVC (Addgene, Plasmid #8449), 6.5 μg envelope plasmid pCMV-VSV-G (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μg/flask of psPAX2 (Addgene 12260) using EndoFectin Lenti transfection reagent (GeneCopoeia ...
-
bioRxiv - Bioengineering 2023Quote: ... together with tFucci(CA)5 plasmid29 (Addgene #153521), as per manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of pVSV-G (Addgene, plasmid # 8454), and 10 μg of the desired plasmid ...
-
bioRxiv - Immunology 2024Quote: ... with 5 µg of HA-HIF1alpha (Addgene#18949) and HA-HIF1alpha P402A/P564A-pcDNA3 (Addgene#18955) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid, #86551). Cells were electroporated using the Neon Transfection System (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µg of pMD2.G (#12259, Addgene) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cell Biology 2022Quote: ... human ubiquitin C-driven CymR Cuo repressor purchased from Addgene (#119907) into pPig-Hygro transposase backbone from Max Wilson ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... mEmerald-ARP2-C-14 (gift from Michael Davidson, Addgene plasmid # 53992); MICAL-L1 (Origene ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... mEmerald-Fascin-C-10 (gift from Michael Davidson, Addgene plasmid # 54094); pARF6(Q67L)-CFP (gift from Joel Swanson ...
-
bioRxiv - Microbiology 2022Quote: ... C-terminal Flag-tagged pCAGGS-SARS2-S-D614 (Addgene plasmid #156420) and pCAGGS-SARS2-S-G614 (Addgene plasmid #156421 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Immunology 2020Quote: mApple-Dectin1A-C-10 was a gift from Michael Davidson (Addgene plasmid # 54883 ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-MAP4-C-1069 was a gift from Michael Davidson (Addgene plasmid # 54152 ...
-
bioRxiv - Microbiology 2022Quote: ... mEmerald-MAP4-C-10 (a gift from Dr. Michael Davidson (Addgene plasmid # 54152 ...
-
bioRxiv - Cell Biology 2024Quote: ... were cloned into the plasmid TVBB C-term-mScarlet (Addgene 169219) with the purpose of knocking in mScarlet in frame with D882 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HAMECs were transfected with mCherry-CD36-C-10 (Addgene: Plasmid #55011), 8µg of plasmid was used per 1 million cells using nucleofection.
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with mCherry-CD36-C-10 (Addgene: Plasmid #55011), 5µg per 10cm dish or 0.5µg per well of a 6-well dish ...
-
bioRxiv - Molecular Biology 2023Quote: ... and C-FLAG-D20 or EGFP (pEGFP-N1-FLAG, Addgene 60360) chimeras were also subcloned into the XhoI and MfeI linearized attb-BSDr vector using the NEBuilder HiFi Assembly Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... mRuby2-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 55889 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCDH-Flag-c-MYC was a gift from Hening Lin (Addgene plasmid # 102626 ...
-
bioRxiv - Cell Biology 2023Quote: ... and inserted into the pScarlessHD-C-3xVHH05-DsRed (Addgene, Plasmid #171580) (63 ...