Labshake search
Citations for Addgene :
1201 - 1250 of 2007 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and pSECRETS-C (p11.LacY.wtx1 plasmid (Addgene #69056) high copy pBR322 ori ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... and Cbh_v5 AAV-ABE C-terminal (Addgene: 137178) and replaced the coding sequence of SpCas9 with the N-or C-terminal parts of Cas9-NRTH ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and GIB-Cre C-terminal (Addgene plasmid #108724) (gifts from the Wong Lab at Boston University) ...
-
bioRxiv - Plant Biology 2024Quote: ... New B/c vectors are available from Addgene: pENTR-B/c (Addgene plasmid #227962) ...
-
bioRxiv - Plant Biology 2024Quote: ... pICSL50009 (6xHA C-terminal tag, Addgene no. 50309), and pICSL60008 (Arabidopsis heat shock protein terminator (AtHSP18 terminator) ...
-
bioRxiv - Plant Biology 2024Quote: ... pICSL50007 (3xFLAG C-terminal tag, Addgene no. 50308), and pICH41414 (35S terminator ...
-
bioRxiv - Plant Biology 2024Quote: ... pICSL50008 (GFP C-terminal tag, Addgene no. 50314), and pICH41414 (35S terminator).
-
bioRxiv - Systems Biology 2024Quote: ... c-Src (pET23a-H6-TEV-cSrc; AddGene: 214233), Abl (pET23a-H6-TEV-cAbl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Cell Biology 2020Quote: ... YFP-Parkin was a gift from Richard Youle (Addgene plasmid #23955)6 and EGFP-LC3 was a gift from Karla Kirkegaard (Addgene plasmid #11546)7 ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Neuroscience 2024Quote: ... and 6 µg the transfer plasmid pLVX-UbC-rtTA-Ngn2:2A:Ascl1 (Addgene #127289) (23) ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with 6 µg of the packaging plasmid psPAX2 (Addgene #12260), 6 µg of the envelope plasmid pMD2.G (Addgene #12259) ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2021Quote: ... over V1 using an ultrafine dental drill and inserted a glass pipette backfilled with AAV2.1-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (titer: 7×1012 vg/mL, 20298-AAV1 Addgene). In total 50 nL was injected in V1 (bilateral binocular V1 for Task A and unilateral V1 for Task B ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml, viral prep #44361-AAVrg, Addgene, US,68). For canine adenovirus (CAV ...
-
bioRxiv - Biochemistry 2021Quote: The guide RNA sequence CAGAATTGGCGCTATGCTAC targeting exon 7 of FUT8 was cloned into px458 pSpCas9(BB)-2A-GFP (Addgene). The resulting plasmid was transfected into Huh7 cells using ViaFect (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... AAVrg-CAG-GFP (titer ≥ 7×1012vg/mL, category number 37825, lot V9234) was purchased from Addgene (Watertown, MA, USA).
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.
-
bioRxiv - Bioengineering 2022Quote: ... To generate H2B-iRFP lentiviral particles HEK 293T cells were plated in a 6-well plate (7×105 cells per well) and transiently transfected with 1.5 μg of pLenti-pGK-DEST-H2B-iRFP vector (Addgene # 90237 ...
-
bioRxiv - Neuroscience 2023Quote: Adult mice were stereotaxically injected at 7-10 weeks of age with 600 nl of 1.5×1013 vg/ml AAV1-CKIIa-stGtACR2-FusionRed (AddGene) or 7×1012 vg/ml AAV1-CKIIa-mCherry control at bilateral ACC (antero-posterior (AP ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... experimental animals received bilateral infusions (0.5 µL/hemisphere) of AAV5-hSyn-DIO-hM3D(Gq)-mCherry (7×1012 vg/mL; Addgene) into the VTA as described in [32] ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was injected with 1μL of AAV2-Ef1a-fDIO-mCherry (7×10¹² vg/mL; Addgene, Catalog #: 114471-AAV2) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Cancer Biology 2024Quote: ... All sgRNAs used for validation (Supplementary Table 7) were cloned into the pLenti-sgRNA(lib)-puro vector (Addgene, #119976) through Golden Gate assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg of psPAX2 (#12260, Addgene), and 5 µg of pMD2.G (#12259 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 μg pRRE (Addgene, plasmid #12251), 2.5 μg pRSV-Rev (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... in primary cortical neurons for 72 hours and for c-Fos expression we were added pOTTC475-pAAV-c-Fos-iRFP (Addgene plasmid-#47906) at DIV 8 ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-Lamin A-C-18 (Addgene plasmid no. 54138) and mEmerald-Nucleus-7 (Addgene plasmid no ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV5-M13-TEV-C-P2A-tdTomato (Addgene plasmid #92391), and AAV5-TRE-EGFP (Addgene plasmid #89875) ...
-
bioRxiv - Biophysics 2022Quote: ... mitochondria labeled by mEmerald-Tomm20-C-10 (Addgene, 54281), Golgi apparatus labeled by GalT-GFP (plasmid was a gift from the Patterson Lab ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plasmid E[beta]C (Addgene cat. no. 24312) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... and mApple-LC-myosin-C-10 (Addgene plasmid #54919) were gifts from Michael Davidson ...
-
bioRxiv - Biochemistry 2023Quote: ... and C-terminal SNAC42 and hexahistidine tags (#191551, Addgene). This yielded final expressed sequences as ...
-
bioRxiv - Biochemistry 2023Quote: ... and C-terminal SNAC42 and hexahistidine tags (#191551, Addgene). This yielded final expressed sequences as ...
-
bioRxiv - Microbiology 2024Quote: ... from the pET28a-C-tag-SpyCatcher-Mi3 (Addgene #112255) and pET15b-StrepTag-SpyCatcher-LS (Novagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA targeting exon 6 of NFKB2 was cloned into lentiCRISPR v2 (Addgene plasmid # 52961), which is a constitutive CRISPR system ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have combined them all in a pX330A-dCas9 1×6 (Plasmid #63600, Addgene). Cloning of oligonucleotides was confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2024Quote: ... grown in wells of 6-well plates with 1000 ng psPAX2 (Addgene plasmid #12260) packaging plasmid ...