Labshake search
Citations for Addgene :
1251 - 1300 of 1446 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Synthetic enhancers were amplified by PCR with primers that included homology to the plasmid vector E1b-GFP-Tol2 (Addgene plasmid #37845)81 and were cloned upstream of the minimal promoter (E1b ...
-
bioRxiv - Neuroscience 2023Quote: ... the transgene p130PH or p130PHR134L were amplified using PCR from the pEGFP-N1 plasmids containing these genes31 and inserted into the Ef1α-DIO-mCherry viral vector (Addgene, #47636). AAVTM6 viruses were produced at Janelia Viral Tools facility ...
-
bioRxiv - Bioengineering 2023Quote: ... the scFv-GCN4-linker-VP16-GB1-Rex NLS sequence was PCR amplified from pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS (Addgene #60904) and cloned into a lentiviral backbone containing an EF1-alpha promoter ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... digesting the PCR generated fragment with HindIII and BamHI restriction enzymes and finally cloning it into the ptdTomato-C1 vector (Addgene, #54653), previously digested with HindIII and BamHI restriction enzymes.
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Cell Biology 2023Quote: ... the strain expressing Hfl1-NG was produced from strain Y1508 by introducing a DNA fragment obtained by PCR using plasmid pFA6a-link-ymNeongreen-SpHis5 (Addgene, #125704) and oligonucleotides #1706 ...
-
bioRxiv - Cell Biology 2023Quote: pENTR H2B mScarlet-I was created by PCR amplification of mScarlet-I from plasmid EB3- mScarlet-I (Addgene #98826, Dorus Gadella), using the primers FW 5’- ACCGGTGAATTCACCATGGTGAGCAAGGGCG-3’ and RV 5’-
-
bioRxiv - Plant Biology 2023Quote: A pair of oligos containing the gRNA sequence were used in conjunction with vector-specific primers (Table S1) for PCR amplification of Medicago truncatula U6 promoter and scaffold from the pUC-gRNA plasmid (Addgene #47024) using Q5® High-Fidelity 2X Master Mix (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... The construct encoding SARS-CoV-2 matrix (M) protein was cloned by PCR amplification of M cDNA from the pDONR 207 SARS-CoV-2 M plasmid (Addgene #141274) using a Forward primer inserting a restriction site for EcoRI and a reverse primer bearing a restriction site for BamHI and a Myc tag ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The ERdd GFP LEU2 donor plasmid SHe146 (Supplementary Data S4) was cloned by Golden Gate assembly from parts PCR amplified from pScDD2_ERdd (Addgene plasmid #109047), pWS082 (Addgene plasmid #90516) ...
-
bioRxiv - Developmental Biology 2023Quote: An enhanced piggyBac Puromycin selectable and DOX inducible vector was digested with EcoRI-NotI and ligated with PCR-amplified human SOX2 from the FUW-tetO-hSOX2 plasmid (Addgene#20724). Transfection into hPSCs was done using Lipofectamine Stem Reagent per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... we amplified a 10xHis-MBP coding fragment by PCR with primers pair 10xHis-MBP-F and 10xHis-MBP-R from pMAL-c2X® vector (Addgene), and cloned it into pTrcHis® vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: The spectinomycin resistance cassette (promoter, aadA CDS and terminator) was PCR-amplified from pAGM1299 (Addgene plasmid # 47988; (Weber et al., 2011)) using Phusion high-fidelity DNA polymerase (New England Biolabs Ltd ...
-
bioRxiv - Bioengineering 2023Quote: ... The P2A-mScarlet fragment was obtained by PCR cloning from pEB2-mScarlet (a kind gift from Dr. Philippe Cluzel; Addgene #104006)(Balleza et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... the lentiviral transfer plasmid constitutively expressing hM3D(Gq)-mCherry was constructed as follows: the sequence encoding hM3D(Gq)-mCherry was amplified by PCR from a plasmid from Addgene (#50474) and assembled into a lentiviral backbone with a human EF1α promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... pLV-mRuby3-MLC-IRES-Neo was created by PCR-amplifying MLC (MYL9) and mRuby3 using pLV-Ftractin-mRuby3-p2A-mTurquoise-MLC-IRES-Blast as templates (Addgene 85146) and by inserting the products into BamHI/NotI-digested pLV-EF1a-IRES-Neo31 (Addgene 85139 ...
-
bioRxiv - Cell Biology 2024Quote: ... Scarlet-tagged constructs were created by Gibson assembly of inserts generated by PCR from βII-spectrin SR1-17:mGreenLantern and αII-spectrin SR8-10:mGreenLantern inserted into pCCL-mScarlet (Addgene, #209889).
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-GfaABC1D-tagBFP-miR30 plasmid was generated by combining the tagBFP sequence with the miR30 sequence (Horizon, pGIPZ plasmid) using overlapping PCR and subcloned into pAAV-GfaABC1D-eGFP plasmid (Addgene #176861). The pAAV-GfaABC1D-tagBFP-miR30-scramble and pAAV-GfaABC1D-tagBFP-miR30-shAckr3 constructs were subcloned into the pAAV-GfaABC1D-tagBFP-miR30 vector with the following target sequences.
-
bioRxiv - Biochemistry 2024Quote: ... FLAG-tagged TDP43 WT or mutant coding DNA sequence (CDS) was PCR amplified and cloned into a doxycycline-inducible pCW vector (Addgene #50661) at NheI (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The GFP- shPten-shPhgdh and GFP-shPten-shRen fragments were then PCR amplified and InFusion cloned into EcoRI-linearized cEF1a-LSL-GFP (Addgene #135672) which was modified to replace the EF1α promoter with a CMV promoter by InFusion cloning ...
-
bioRxiv - Immunology 2024Quote: ... each RBD variant was tagged with a unique 26-nucleotide (N26) barcode via PCR and assembled into Yeast surface display vector (Addgene, 166782). The XBB.1.5 and JN.1 DMS libraries were further transfected into electrocompetent DH10B cells for plasmid amplification and proceed to PacBio sequencing library preparation to decipher the association between RBD variant and corresponding N26 barcode ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pCEBZ-Flag-GST-PLAT expressing various N-terminally Flag-tagged proteases were generated by PCR amplification of the respective sequences from the plasmids pDONR223-furin (Addgene #82122), p-hCathepsin L (Addgene #11250) ...
-
bioRxiv - Neuroscience 2024Quote: ... was made by replacing coding sequences from the rabies oG protein with orthologous sequences from N2cG (PCR amplified from Addgene #73481). High scoring predicted splice donor and splice acceptor sites on the N2cG sense sequence were mitigated by introduction of synonymous codon substitutions to enhance protein expression.26 pAAV-ehSyn-fDIO-TVA950-eYFP ...
-
bioRxiv - Cell Biology 2024Quote: ... pLVX-EF1a-H2B-emiRFP703-neo was created by PCR of H2B-emiRFP703 from pH2B-emiRP703 (a gift from Vladislav Verkhusha, AddGene #136567) with primers 5’-ATGCCAGAGCCAGCGAAG-3’ and 5’-TTAGCTCTCAA-GCGCGGTGATC-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: pLEX-FLAG-Cre-GFP was generated by cloning PCR-amplified N-terminal FLAG tagged Cre-GFP (from pCAG-Cre-GFP; Addgene #13776) (Forward primer ...
-
bioRxiv - Cancer Biology 2024Quote: The TWEAK overexpression construct was generated by amplifying the soluble TWEAK (sTWEAK) sequence from cDNA through PCR and this was cloned into pLJM1-EGFP (Addgene; 19319), replacing EGFP ...
-
bioRxiv - Genetics 2024Quote: ... We generated SiT-ddCas12a-[Repr] by introducing the DNase-inactivating E993A by PCR-based mutagenesis using SiT-Cas12a-[Repr] (Addgene #133568) as template ...
-
bioRxiv - Neuroscience 2024Quote: ... DsecattP40-flip-out-3xP3-DsRed was generated by PCR amplification of pJFRC208-10XUAS-FRT>STOP>FRT-myr::smGFP-HA53 (Addgene #63166) and integration into Dsec-attP40-3xP3-DsRed.
-
bioRxiv - Molecular Biology 2024Quote: ... pL2M-CMV-MPH-P2A-Puro was cut using NheI-HF and BamHI-HF and the resulting vector backbone was used for Gibson Assembly with gBlock 5169 (see above) and a fragment containing p300Core-HA tag that was PCR amplified from pcDNA-dCas9-p300 (Addgene # 61357) using primers 5372/5373 ...
-
bioRxiv - Biochemistry 2024Quote: ... genes were PCR-amplified with the primers listed in Table S1 using the following templates: RFK: pDONR223-RFK (Addgene plasmid #23698) [16] ...
-
bioRxiv - Developmental Biology 2024Quote: ... Nucleotide fragments of EGFP and hPDGFRB(512-561) were PCR-amplified from pHR-EGFPligand (a generous gift from Wendell A. Lim, Addgene #79129). Nucleotide fragments for PCR-amplification of LaM4 ...
-
bioRxiv - Genomics 2024Quote: ... The cassette containing the CmR and ccdB genes was amplified by PCR from the pSTARR-seq_fly-hsp70 plasmid (Addgene #71500, (18)) ...
-
bioRxiv - Cell Biology 2024Quote: ... a FLAG-RPB1-N792D-ΔCTD fragment was PCR amplified (Forward primer: 5’ – CAATTCCACAACACTTTTGTCTTATACTTGGATCCATGGACTACAAGGACGACGATGACA - 3’; Reverse primer: 5’ – TAGGGGGGGGGGAGGGAGAGGGGCCGGCCGGGGCTCAGCTGGGAGACATGGCACCAC – 3’) from FLAG-Pol2-WT (Addgene, 35175) (55 ...
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid # 19068) by MultiSite Gateway cloning according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... elegans expression plasmid pPD49.26 by PCR and cloned into the pLenti PGK Puro DEST (w529-2) vector backbone (Addgene plasmid #19068) by MultiSite Gateway cloning according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product was digested with XbaI and cloned into the XbaI site of the pTrex-n-eGFP plasmid (ADDGENE: #62544). LpBBS1 ...
-
bioRxiv - Cell Biology 2024Quote: The sgRNAs were made by in vitro transcription for which the DNA templates were prepared by PCRs on plasmid pPUR-hU6-sgRNA-Sirius-8XMS2 (Addgene #121942) as the template encoding the optimized tracr RNA sequence with the integrated MS2 stem loops50 ...
-
bioRxiv - Plant Biology 2024Quote: ... and terminators) from the GB2.0 kit purchased from Addgene (https://www.addgene.org/kits/orzaez-goldenbraid2/) ...
-
bioRxiv - Genomics 2023Quote: ... transfection kit and packaging plasmids pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Cell Biology 2020Quote: Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Cell Biology 2020Quote: ... primary miRNAs for miR-29a and miR-16 were amplified from genomic DNA by PCR and cloned into the pAdTrack shuttle (Addgene, Plasmid#16404). The miR-16 pAdTrack plasmid was then mutated by site-directed mutagenesis to induce 3 point mutations into the miR-16 seed sequence ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tol2-mCherry was produced by digesting Tol2-EGFP-C1 with NheI/EcoRI to remove GFP and inserting mCherry amplified by PCR from 8xGliBS-IVS2-mCherry-NLS-polyA-Tol2 (a gift from James Chen (Addgene plasmid #84604), Mich et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Cancer Biology 2022Quote: A Piggybac version of the FUCCI reporter (BII-ChPtW-iresFUCCI) was constructed by PCR amplification of the Clover-Geminin-ires-mKO2-Cdt fragment from pLL3.7 (Addgene Plasmid #83841, [33]) and insertion into unique BsmBI sites within the Piggybac vector BII-ChPtW ...
-
bioRxiv - Molecular Biology 2020Quote: dCas9 repressor was PCR-amplified with primers containing SfiI sites from dCas9-KRAB-MeCP2 (a gift from Alejandro Chavez & George Church; Addgene plasmid #110821) (Yeo et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... a fragment encoding the residues 1382-1690 was cloned by PCR as a XhoI-NotI fragment from the pFRT/TO/FLAG/HA-DEST TNRC6C vector (Addgene plasmid 19885) (52 ...
-
bioRxiv - Immunology 2021Quote: ... GFP-YVAD was PCR-amplified from pEGFP-C3 and cloned into the Lamp1-RFP plasmid (a gift from Walter Mothes; RRID: Addgene Cat.#1817) (Sherer et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... double-stranded DNA sequences complementary to the target sequences were generated by PCR and then cloned into the pSpCas9(BB)-2A-GFP (PX458) vector (AddGene, cat. # 48138) (Table S1) ...
-
bioRxiv - Cell Biology 2021Quote: ... The amplified PCR product was digested with NheI and EcoRI enzymes and inserted into linearized pLJM1 plasmid (gift from David Sabatini, Addgene, plasmid# 19319). Whole plasmid sequencing was performed to confirm that the DN-FYN sequence was correct ...