Labshake search
Citations for Addgene :
1251 - 1300 of 1371 citations for Mouse Anti Hepatitis B Virus X Protein Antibody 1884 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... Reprogramming was carried out by transducing MEFs with a doxycycline-inducible mouse OKSM (pHAGE2-tetO-STEMCCA)(Sommer et al., 2009) and rtTA (FUdeltaGW-rtTA, Addgene 19780)(Maherali et al. ...
-
bioRxiv - Biophysics 2021Quote: ... HeLa cells were stably engineered to display a doxycycline-inducible GFP fused to a mouse CD80 transmembrane domain using standard second-generation lentivector production protocols and the plasmids pMD2G (Addgene 12259), pCMVR8.74 (Addgene 22036) ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Cell Biology 2021Quote: ... The expression vector for N-terminally FLAG-tagged mouse SYDE2 was generated by PCR amplification of the coding sequence from pNICE HA-mSYD1B (Addgene #59362) and insertion into pcDNA3-FLAG by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: DNA templates used for in vitro transcription of mouse Xist RNA were amplified from sequence verified plasmid pCMV-Xist-PA (Wutz and Jaenisch, 2000) (Addgene 26760), containing the murine Xist gene using high-fidelity Platinum® pfx DNA polymerase (Invitrogen™) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Cell Biology 2022Quote: The S1R-Apex construct was generated by cloning a gene synthesized product containing the cDNA sequence for mouse S1R into the pCDNA3_Sec61B-V5-APEX2 vector (Addgene plasmid 83411) (67) ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Constitutive active form of mouse ChREBP was subcloned into pMSCVhyg-3xT7 to generate pMSCVhyg-3xT7-CA-ChREBP using full length clone as templates (Addgene #39235). All plasmids were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2021Quote: ... The Cherry Brie pooled CRISPR library was obtained by Gibson assembly cloning to place the sgRNA sequences form the Mouse Brie CRISPR knockout pooled library (a gift from David Root and John Doench (Addgene #73633)) into the LentiGuide-Cherry plasmid (Supplementary Figure 1A) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression construct for mouse MLXIPL was generated by PCR-amplification from a template plasmid (from the laboratory of Isabelle Leclerc, Addgene #39235) and cloned into pcDNA3 with an N-terminal FLAG epitope tag by Gibson assembly ...
-
bioRxiv - Molecular Biology 2023Quote: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The reference was generated from the mouse genome (GRCm38) and annotation (GRCm38.93) and modified to include the sequences for tdTomato (Addgene plasmid # 22799) (Madisen et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... 377 million iCas9-expressing NIH-3T3 cells were transduced with the Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Wang et al, 2017) (Addgene; 1000000096) using spinfection at an MOI of 0.3 to ensure a final library coverage of 500X ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV expressing GCaMP6f under the control of the GABAergic neuron-specific enhancer of the mouse Dlx (mDlx) gene (Addgene# 83899-AAV1) (124) ...
-
bioRxiv - Developmental Biology 2022Quote: ... guide RNA targeting the first exon of the mouse NHE1 gene was designed and cloned into an all-in-one doxycycline (Dox)-inducible vector TLCV2 (Addgene #87360). In brief ...
-
bioRxiv - Microbiology 2022Quote: The mouse Brie pooled sgRNA library on the lentiGuide-Puro backbone was obtained from David Root and John Doench (Addgene #73633) (23) ...
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCAGEN-Ntn4 expression plasmid was constructed by cloning the full-length coding sequence out of mouse Ntn4-AP-His plasmid (Addgene 71980) using the primers in Table 1 ...
-
bioRxiv - Genetics 2023Quote: The gRNA library used for the screening was the Mouse Improved Genome-wide Knockout CRISPR Library v2 (a gift from Kosuke Yusa, Addgene, #67988) (48) ...
-
bioRxiv - Developmental Biology 2023Quote: Single guide RNAs (sgRNAs) targeting each of the specific target genes were retrieved from the Mouse CRISPR Knockout Pooled Library (Addgene #73632). Two sgRNA sequences were selected per gene of interest (for sgRNAs sequences ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 12ug of each pTwist Lenti Puro SFFV WPRE lentiviral construct encoding either human or mouse PRLR were co-transfected with 9ug of psPAX2 (Addgene; 12260) and 3ug of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... sgRNAs were selected from either the Brunello (human) or Brie (mouse) libraries and cloned into either lentiCRISPR v2 or lentiCRISPR v2-Blast (Addgene #83480). Lentivirus was produced and used to infect indicated cell lines ...
-
bioRxiv - Developmental Biology 2024Quote: ... of Fbxo24 and Skp1 were cloned and amplified using cDNA obtained from mouse testis and inserted into the multiple cloning site of pCAG1.1 vector (Addgene; Plasmid #173685). To generate the expression vector coding Fbxo24(ΔF-box) ...
-
bioRxiv - Cell Biology 2024Quote: sgRNA sequences targeting Atg7 (CACCGTCTCCTACTCCAATCCCGTG), Pcyt2, (CACCGCCATGATCCGGAACGGGCA) or a non-genic region on mouse chromosome 8 (Chr8, ACATTTCTTTCCCCACTGG) were cloned into lentiCRISPRv2 (Addgene, 52961). sgRNA sequences targeting Trp53 (GAAGTCACAGCACATGACGG ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides were cloned into either the pX602-AAV-Cre sgRNA backbone for CRISPR/Cas9-induced acute gene knockout in mouse liver or the pLentiCRISPR V2 (Addgene, 52961) & pLentiGuide Blast for genome editing in cell lines ...
-
bioRxiv - Developmental Biology 2021Quote: Tol2-enhanced green fluorescent protein (EGFP)-C1 was prepared by digesting pT2-7xTcf-NLS-CNL-CP (a gift from Yasushi Okada (Addgene plasmid #65715), Takai et al ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 nucleotide guide RNA (gRNA) sequence targeting the IRF7 protein-coding region was inserted into the lentiCRISPRv2 vector (Addgene; catalog #52961). The IRF7 guide sequences used was ...
-
bioRxiv - Biochemistry 2022Quote: Plasmids encoding the full-length spike proteins with native signal peptides were cloned into the background of the HDM-SARS2-Spike-delta21 plasmid (Addgene Plasmid #155130). This construct contains a 21 amino acid c-terminal deletion to promote viral expression ...
-
bioRxiv - Molecular Biology 2021Quote: FUS-ΔIDR-SHARP was generated by recombining the ΔIDR-SHARP entry clone into a modified version of the PB-HALO-IRES-NGFR vector containing the IDR sequence from the FUS protein tagged with mCherry (Addgene plasmid 101223) in place of HALO ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei of opsin-positive cells were visualized using a Histone2B fusion protein with mTFP1 (a gift from Robert Campbell & Michael Davidson; Addgene plasmid # 54553; http://n2t.net/addgene:54553;RRID:Addgene_54553; Ai at al., 2006).
-
bioRxiv - Neuroscience 2022Quote: ... an enhanced green fluorescent protein (eGFP) under the CaMKIIα promoter was used (AAV9-CaMKIIα-eGFP-WPRE; Addgene #50469, 2.4E+13 GC/mL). We infused the AAV in the dorsal hippocampus through the following coordinates relative to bregma ...
-
bioRxiv - Physiology 2022Quote: ... An optimized rat insulin promoter (RIP) (50) and the coding sequence of hM4D(Gi)-mCherry (Gi/o-coupled DREADD-mCherry fusion protein; Plasmid #75033; Addgene, Watertown, MA) (80 ...
-
bioRxiv - Biophysics 2022Quote: ... media was refreshed with standard growth media and cells were co-transfected with SNAP-mGluR2 (no FLAG-tag) and chimeric G protein (Gqo5, Addgene plasmid #24500) (1:2 w/w ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Developmental Biology 2022Quote: The pTT3-eGFP vector was constructed by replacing the C-terminal tag encoding region of a bait protein vector (52) (Addgene ID 36150) with eGFP ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Biophysics 2019Quote: ... an N-terminal LCTPSR FGE recognition motif on Cas1 was inserted by site-directed mutagenesis in plasmid pWUR871 with primers in Table S1 and co-expressed with FGE proteins (Addgene, plasmid #16132) (Carrico et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ECFC-EC and cancer cells were transduced with lentivirus expressing mCherry (LeGO-C2, plasmid # 27339), green fluorescent protein (GFP) (LeGO-V2, plasmid # 27340), or azurite (pLV-Azurite, plasmid # 36086) (Addgene, Cambridge, Massachusetts)39,40 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ECFC-EC and cancer cells were transduced with lentivirus expressing mCherry (LeGO-C2, plasmid # 27339) or green fluorescent protein (GFP) (LeGO-V2, plasmid # 27340) (Addgene, Cambridge, Massachusetts). To load the microfluidic device ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Immunology 2022Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Neuroscience 2022Quote: ... an injection of AAV1 carrying a fused channelrhodopsin2-YFP protein (AAV1-hSyn-ChR2-H134R-eYFP- WPRE, Addgene, viral prep no. 26973-AAV1) was placed into either MEC ...
-
bioRxiv - Cell Biology 2023Quote: ... polyspora Hop1319-529 into UC Berkeley Macrolab vectors to generate N-terminal TEV protease-cleavable His6- or His6-maltose binding protein tags (Addgene #29666, 29706). DNA binding mutants of S ...
-
bioRxiv - Molecular Biology 2023Quote: ... the N-terminal part of FUS protein was used from the plasmid pHR-FUSN-mChr-CRY2WT (a gift from Clifford Brangwynne; Addgene plasmid # 101223). The N-terminal part of SATB1 was cloned into the pCMV-CRY2-mCherry vector using a single BspEI restriction enzyme site from the full-length construct ...
-
bioRxiv - Physiology 2023Quote: ... with the carboxy tail fused to either the N-fragment (VN) or the C-fragment (VC) of the Venus protein (27097, 22011; Addgene, Cambridge, MA), auxiliary subunits CaVα2δ ...
-
bioRxiv - Cancer Biology 2022Quote: ... sequences were removed from the pMXPIE-AID retroviral vector [67] and the resulting backbone was linked to the orange fluorescent protein gene mOrange2 (from Addgene, plasmid # 45179) [68] ...