Labshake search
Citations for Addgene :
1151 - 1200 of 1371 citations for Mouse Anti Hepatitis B Virus X Protein Antibody 1884 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... encoding the Cre enzyme fused to the green fluorescent protein (GFP) under the control of the human synapsin promoter was obtained from Addgene (AAVrg.hSyn.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Molecular Biology 2024Quote: ... One million cells were transfected with the corresponding pools of guide RNAs and with the pX458 plasmid encoding for Cas9 and GFP proteins (48138, Addgene), using lipofectamine 2000 ...
-
bioRxiv - Biochemistry 2023Quote: ... the C162A mutant and the C162L mutant were independently cloned and expressed as 6× His-SUMO fusion proteins from the expression vector pAL (Addgene). BL21 (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: OsKAI2 and the OsKAI2int mutant were independently cloned and expressed as GST (Glutathione-S-Transferase) fusion protein from the expression vector pCOOL (Addgene). BL21 (DE3 ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected AAVPHP.eB (1012 vg/ml) encoding a red fluorescent protein fused to an opsin (pAAV-TRE3G-BiPOLES-mKate2 (Addgene # 192579)) to label the membrane of cFos+ neurons ...
-
bioRxiv - Microbiology 2024Quote: ... using an engineered plasmid that encodes a deGFP protein and a malachite green RNA aptamer (PT7-deGFP-MGapt was a gift from Richard Murray, via Addgene plasmid # 67741 ...
-
bioRxiv - Neuroscience 2023Quote: ... coding sequences of GFP-NLS-tetR fusion protein was synthesized and cloned into UAS expression plasmid pJFRC-MUH (Addgene #26213) by GenScript Biotech ...
-
bioRxiv - Bioengineering 2023Quote: ... Human codon optimized DisCas7-11 protein sequence and the mature DR guide scaffold with golden gate sites were PCR amplified from Addgene plasmids # 172507 and #172508 ...
-
bioRxiv - Developmental Biology 2023Quote: ... we aimed to substitute the endogenous Cas9 cassette by targeting the Cas9 protein to the Cas9 DNA flanking regions either with a dCas9-VP64 donor sequence from Addgene plasmid 61425 or a dCas9-KRAB donor ...
-
bioRxiv - Cell Biology 2023Quote: ... a sequence encoding the tdTomato fluorescent protein was amplified from a pBa-KIF5C 559-tdTomato-FKBP plasmid (Addgene, Cat. #64211) and inserted into the linearized FHUGW-CRE-DD-zsGreen plasmid by In-Fusion cloning.
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Biochemistry 2023Quote: Catalytically inactive Mpro C145A mutants used for protein crystallography experiments were prepared by subcloning Mpro C145A from Addgene (catalog #141371) into a pET28a expression vector containing an N-terminal His-tag and tobacco etch virus (TEV ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The CASE Gs protein construct is that designed and optimised by the Schulte lab (Schihada et al., 2021) and were obtained from Addgene. Mammalian mini-Gs constructs were a kind gift from Nevin Lambert (Wan et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µg of pX330 plasmid containing sgRNA for the target protein and 0.2 µg of pcDNA3-FKBP-eGFP-HOTag3 (Addgene, #106924) were co-transfected using Lipofectamine 2000 (Thermo Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Cancer Biology 2023Quote: Autophagy degradative activity (autophagic flux) was measured using an expression vector encoding the fusion protein mCherry-EGFP-LC3B (Addgene, #22418). We transfected JHU 011 cell line with pBabe-mCherry-EGFP-LC3B vector and established a stable cell line by puromycin selection ...
-
bioRxiv - Genomics 2023Quote: ... pmCherry was a 4.7kb plasmid that expressed mCherry fluorescent protein under the control of a CMV promoter (Addgene, Cat# 632524). L1 plasmids consisted of pUBC-L1SM-UBC-EGFP and pMut2-UBC-L1SM-UBC-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... University of North Carolina Vector Core) or an enhanced yellow fluorescent protein control (eYFP; N = 13, 6 males; pAAV5-Ef1a-DIO-eYFP, Addgene). Virus (0.2 µl ...
-
bioRxiv - Plant Biology 2024Quote: ... the constructs encoding S10-tagged and S11-tagged protein fusions were co-expressed in the presence of UBQ10:sXVE: GFP1–9 (Addgene plasmid # 108187 ...
-
bioRxiv - Cell Biology 2024Quote: ... Short hairpin RNAs (shRNAs) targeting WSB2 or BCL-2 family proteins were subcloned into the pLKO.1 puro vector (Addgene) for gene KD ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 μg of the plasmid encoding the Strep-tagged nucleocapsid protein was packaged with 9.183 μg of psPAX2 (Addgene #12260) and 2.768 μg of pVSV-G (Addgene #138479 ...
-
bioRxiv - Microbiology 2024Quote: ... antibiotic resistance cassettes (KanMX, hphMX) and fluorescent protein genes (EGFP, mCherry, mCitrine, mTagBFP2) were obtained from plasmids ordered from AddGene (#44900 ...
-
bioRxiv - Cancer Biology 2024Quote: ... with the plasmid of interest (POI) and two plasmids encoding packaging proteins for viral vector (pAX.2 Addgene Plasmid #35002), pMD2.G Addgene Plasmid #12259) ...
-
bioRxiv - Immunology 2024Quote: ... VDJ sequences were ordered from IDT and cloned into the vector AbVec antibodies (Addgene)
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The plasmid MyosinIIA-GFP [23] that encodes for mouse GFP-Myosin9 was a gift from Matthew Krummel (Addgene plasmid #38297).
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Microbiology 2021Quote: The genome-scale CRISPR-Cas9 screen was performed using the mouse GeCKOv2 sgRNA library as previously described (Fig. 1A) (Addgene) [36] ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were infected at low viral titer with the pooled mouse CRISPR lentiviral library containing 78,637 gRNAs targeting 19,674 genes (Addgene #73633-LV). Infected cells were selected with puromycin (1 μg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... The gene encoding mouse E1 was a kind gift from Jorge Eduardo Azevedo (Addgene plasmid 32534, (Carvalho et al., 2011)) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Immunology 2020Quote: ... The donor plasmid (pW290) used to target the endogenous mouse Wapl locus was constructed by modifying a published pMK290 plasmid (Plasmid #86230, Addgene). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: Mouse SEMA6A-Fc and SEMA6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively) and human SEMA6A was gene-synthesized (GeneArt) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mouse Sema6a-Fc and Sema6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively). Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript) ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding for mouse neurofilament light chain (NFL) was amplified from the vector pmNFL (a gift from Anthony Brown, Addgene plasmid #83127 ...
-
bioRxiv - Genetics 2020Quote: The mouse Erk1 gene gRNA (GGTAGAGGAAGTAGCAGATG) and mouse Erk2 gene gRNA (GGTTCTTTGACAGTAGGTC and CTTAGGGTTCTTTGACAGT) were cloned into pX330 vector obtained from Addgene. The target vector and pEF1a-pac vector were co-transfected (5:1 ratio ...
-
bioRxiv - Immunology 2021Quote: The lentiviral gRNA plasmid library for genome-wide CRISPR-Cas9 screen (Mouse Improved Genome-wide Knockout CRISPR Library v2, Pooled Library #67988#) and mock vector (#67974) was obtained from Addgene. The library was amplified following the protocol provided by Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.
-
bioRxiv - Immunology 2022Quote: ... SpCas9-expressing Nrp1-/- NIH/3T3 fibroblasts were then transduced with the Mouse Brie CRISPR knockout lentiviral prep (Addgene #73633-LV) as described previously (Doench et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of mouse ARNTL was synthesized (Twist Biosciences) and cloned into the NheI site of FUW-TetO-MCS (Addgene plasmid #84008 ...
-
bioRxiv - Neuroscience 2024Quote: ... was cloned in-frame to the N-terminal domain of the mouse NFL gene (derived from pmNFL; Addgene ID 83127) using the NEBuilder HiFi DNA Assembly cloning kit (New England Biolabs E5520S) ...
-
bioRxiv - Neuroscience 2023Quote: Wild type (WT) and mutant variants of mouse p38γ were cloned into a pULTRA plasmid,42 a gift from Malcolm Moore (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 µg of mouse Lamin B1 or Lamin B2 or Lamin B3 plasmids conjugated with myc-tag (pCS2-MT, Addgene). Cells were incubated for 48h in a DMEM cultivation medium (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... The oligodendrocyte-specific mouse-derived MBP promoter was amplified from the pAAV-MBP-2xNLS-tdTomato gift from Viviana Gradinaru (Addgene plasmid # 104054 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the HDR donor plasmid derived from Mouse 5’ Npm1-AID-GFP-PuroR plasmid (a gift from Mark Groudine, Addgene plasmid #127899 ;http://n2t.net/addgene:127899 ...
-
bioRxiv - Biophysics 2024Quote: ... studies with an anti-YFP-nanobody (Addgene plasmid #61838) (Hartano et al ...