Labshake search
Citations for Addgene :
1201 - 1250 of 1904 citations for RGPD1 2 3 4 5 8 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... A 1:2 viral mixture of pENN.AAV.CamKII 0.4.Cre.SV40 (Addgene, diluted 1:100,000) and pAAV-hSyn-DIO-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17446) (Campeau et al. ...
-
bioRxiv - Microbiology 2019Quote: ... GM-CSF and IL-4 were produced from HEK293 cells transduced with pAIP-hGMCSF-co (Addgene #74168) or pAIP-hIL4-co (Addgene #74169) ...
-
bioRxiv - Genetics 2021Quote: The Drosophila CRISPR genome-wide knockout library was previously described and is available from Addgene (134582-4)20,55 ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Neuroscience 2023Quote: Viral vectors encoding the fluorescent dopamine indicator dLight1.2 (AAV5-hSyn-dLight1.2) (Addgene, titer ≥ 4×10¹² vg/mL) and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40 ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Cell Biology 2023Quote: Linear tetra-ubiquitin fused to GST (GST-4×Ub) was cloned into a pGEX-4T1 vector (RRID:Addgene_199779). After the transformation of the pGEX-4T1 vector encoding GST-4×Ub in E ...
-
bioRxiv - Neuroscience 2024Quote: ... was injected with a mixture of Cre-expressing and Cre-dependent adeno-associated viral vectors carrying the genes for ChR2 and tdTomato (AAV9.CamKII.4.Cre.SV40 and AAV9.CAG.Flex.ChR2.tdTomato, Addgene). Following a post-injection survival period of 9 weeks ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
Cytonemes coordinate asymmetric signaling and organization in the Drosophila muscle progenitor nichebioRxiv - Developmental Biology 2022Quote: ... The T2A-nls:Gal4:VP16-STOP sequence was generated by PCR (Supplementary Table 3) from the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB vector (Addgene). 5’HA-T2A-nls:Gal4:VP16-STOP-3’HA was assembled in correct 5’-to-3’ order between Not1 and EcoR1 sites of the pJet1.2 vector.
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Molecular Biology 2019Quote: ... sgRNAs that target the 3′ end of the respective coding sequences were cloned into hSpCas9 plasmid (PX458, Addgene Plasmid #48138) (Ran et al ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Microbiology 2022Quote: C-terminal endogenous tagging of loci was performed in TgPRUΔKu80ΔHXGPRT by targeting the 3’UTR of ROCY1 with a specific gRNA cloned into the pUniversal-CAS9 plasmid (Addgene #52694) and then co-transfected with a homology repair cassette amplified from the pLIC-HXGPRT plasmid (as outlined in (Fox et al. ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... eft-3::hpo-9 or BTBD9 alone were co-injected into tm3719 strain with pG2M36 (myo-3::dsRed) and pBCN27-R4R3 (rpl-28::PuroR, Addgene), which were used as the selective markers for transformation ...
-
bioRxiv - Genomics 2022Quote: ... 12 μg of plasmid library was cotransfected with 9 μg psPAX2 and 3 μg pMD2.G (Addgene #12260 and #12259) into HEK293FT cells using 72 μl Lipofectamine 2000 (Life Technologies #11668019) ...
-
bioRxiv - Neuroscience 2019Quote: ... The intracellular solution also contained 50 µM of the red fluorescent dye AlexaFluo 594 and 3 plasmids with the following concentrations42: 100µg/µL pCAG-dsRed2 (Addgene #15777), 200 µg/µL pCMV-oG48 (Addgene 74288 ...
-
bioRxiv - Cancer Biology 2019Quote: ... SENP8) clonal Cas9 expressing BC-3 cells were transduced with lentiviral sgRNA vectors based on pLenti-guide puro (Addgene #52963)34 ...
-
bioRxiv - Synthetic Biology 2019Quote: All single guide RNAs were cloned in BbsI-linearized pCFD3-dU6:3 gRNA plasmid (a gift from Simon Bullock; Addgene plasmid # 49410 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The CRISPR line robo1ΔWIRS was generated by cloning a guide targeting the WIRS motif into a pCFD3-dU6:3 backbone (Addgene, #49410) and sending positive clones to BestGene Inc ...
-
bioRxiv - Molecular Biology 2019Quote: ... was chosen to target the TIP5 locus on exon 3 three base pairs upstream of the ATG start codon and was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene). This plasmid was co-transfected with the HDR repair template plasmid containing the FLAG/HA inclusion flanked by 1kb homology arms into wild type ESCs at a molar ratio of 1:3 ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Genetics 2019Quote: ... Only a single site upstream of the c(3)GccΔ1 deletion was selected (AAAGCTTTGTTGGCCTGTATTGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense (CTTCGAAAGCTTTGTTGGCCTCTAT ...
-
bioRxiv - Cell Biology 2019Quote: ... The guide RNA sequences used to generate TDP43 KO cell lines (summarized in Supplemental Table 3) were annealed and cloned into the BbsI site of pSpCas9(BB)-2A-Puro vector (px459, Feng Zhang, Addgene). Sub-confluent Hela cells were transfected with 1µg of px459 vector using FuGENE 6 (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: Using the Neon transfection system pre-set program #16 (1400V, 20ms, 3 pulses) plasmids used for reprogramming (available from Addgene) were EN2L ...
-
bioRxiv - Genetics 2020Quote: ... Plasmids generated for this work for heat shock Cas9 expression (pJJF152) and proof of concept sgRNAs (targeting SECGFP, dpy-10, sqt-3) will be available from Addgene as indicated in a supplementary table or for specific sgRNAs upon direct request from the authors.
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig. 2F,G and Supplementary Movie 3; Vigene Biosciences; 2.5 x 1012; Addgene plasmid #105677); AAV1-hSyn-DIO-TVA66T-tdTomato-CVS-N2cG (Fig ...
-
bioRxiv - Developmental Biology 2021Quote: ... gRNAs targeting exon 3 of the zebrafish atg13 orthologue (Ensembl: ENSDART00000052324.6; zgc:63526) were cloned into the pT7-gRNA plasmid (Addgene #46759) and generated according to Jao et al ...
-
bioRxiv - Biophysics 2019Quote: ... the in-frame GFP fusion from pUAST-GFP-Clc [3] was excised with an EcoRI/BglII digest and replaced with mEmerald (Addgene), PCR amplified with primers GGAATTCCACCATGGTGAGCAAGGGCGAGG and CGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG (the EcoRI and BglII sites in the primers are underlined) ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Suppl. Table 3) in the BbsI restriction sites of pX459 (#62988, Addgene). An empty pX459 vector was used to generate matching negative control cell lines ...
-
bioRxiv - Neuroscience 2022Quote: ... using an ultra-fine dental drill and inserted a glass pipette backfilled with AAV2-CamkIIa-hChR2(H134R)-EYFP (titer: 3×10¹² viral genomes per ml, 26969-AAV2, Addgene). AC was approached similar to extracellular recordings ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (300 nL; 3×1011 GC/ml; Serotype:9; Addgene, Massachusetts, USA) was unilaterally injected into the right MePD using a 2-μL Hamilton micro syringe (Esslab ...
-
bioRxiv - Neuroscience 2022Quote: Virus expression: pulled glass pipettes were used to inject 500nL of AAV5-mDIx-Chr2-mCherry-Fishell-3 (plasmid no.83898, Addgene, USA ...
-
bioRxiv - Biochemistry 2023Quote: The 6xHis-SUMO-14-3-3ζ construct used in this work (kind gift of prof. B.M. Burmann) was derived from GST-14-3-3ζ (Addgene #13278)26 ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were electroporated at DIV0 just before plating with 3 µg of the plasmid control encoding for Td-tomato alone (pCAG td Tomato, Addgene) or 3 µg of plasmid encoding for Cre-recombinase and reporter gene Td-tomato (pCAG td Tomato-Ires-Cre ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Genomics 2023Quote: ... we designed a gRNA that targets the 3’ end of the SOX2 stop codon (Supplementary Table S25, Addgene plasmid #163752). We then amplified ∼800 bp homology arms upstream and downstream of the gRNA target sequence using high-fidelity Phusion Polymerase ...
-
bioRxiv - Cell Biology 2023Quote: eGFP with three perfect miR430 target sites in its 3’UTR (eGFP-3xPT-miR430b) was inserted in the pCS2+ plasmid (Addgene) as described before 24 ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Cell Biology 2023Quote: ... The RNAi clone that targets the 3’UTR of CDC-42 was generated through amplification of genomic CDC-42 3’UTR (Fwd: gaagatctgaacgtcttccttgtctccatgt; Rev: ggggtaccacgtaacggtgtatccggac) and insertion into the L4440 plasmid (#1654 Addgene). Control bacteria is transformed with empty L4440 vector (#1654 Addgene).
-
bioRxiv - Genomics 2024Quote: ... and the top 3 sgRNAs were individually cloned into single sgRNA expression vectors with direct capture cs1 sequences (Addgene # 122238)10 using restriction digest (BstXI and BlpI ...
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Neuroscience 2024Quote: ... the ReaChR virus was co-injected unilaterally into the LC with AAV9-hSyn-FLEX-jGCaMP8m (3 × 1013 gc/mL, 162378-AAV9 from Addgene) or with AAV9-hSyn-GRABNEm (2-9 × 1013 gc/mL ...