Labshake search
Citations for Addgene :
1051 - 1100 of 1904 citations for RGPD1 2 3 4 5 8 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276; http://n2t.net/addgene:73276 ; RRID:Addgene_73276) General yeast manipulation ...
-
bioRxiv - Neuroscience 2023Quote: ... oligonucleotide pairs (Extended Data Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410) as described52 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898; http://n2t.net/addgene:83898; RRID:Addgene_83898) 51 to express ArchT 67 fused to TS-EYFP-ER sequence that was cloned from a pcDNA3.1 CMV-ChRmine-TS-EYFP-ER plasmid gift of the Hegemann laboratory at the Humboldt Universität ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 Chrna2-Crewt/wt) were first injected bilaterally with 300 nl of AAV9-hSyn-DIO-hM3Dq-mCherry (Addgene, LOT 44361-AAV9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmid encoding the sequence of the cleavage site for Caspase 3 (DEVD) and FLIP-GFP reporter (Addgene# 124428) was digested using the NheI_HF and XmaI (New England Biolabs ...
-
bioRxiv - Genetics 2024Quote: ... using 3 µg of pCAG-NLS-HA-Bxb1 plasmid (a kind gift from Pawel Pelczar (Addgene plasmid #51271) (Hermann et al ...
-
bioRxiv - Neuroscience 2024Quote: ... and the 3′ UTR of Rh1-RA were synthesized and cloned into the pBFv-UAS3 plasmid (Addgene #138399). The sequence of the resultant plasmid is provided in the Supporting Information Text ...
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: mRFP-FKBP-5-ptase-dom and PM-FRB-CFP plasmids were obtained from Addgene (deposited by the laboratory of T ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl cold lysisg/μl cold lysisl pCAGG>nls-hCas9-nls-GFP (Addgene #99141) and 3 μl cold lysisg/μl cold lysisl U6.3>Lhx5/Sox1/Six3 gRNA f+e was microinjected together with the Fast Green solution (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the sequence of Francisella novicida cas12a was amplified from pUDC175 (Addgene plasmid #103019, (5)) using primers 13553-13554 ...
-
bioRxiv - Molecular Biology 2020Quote: The hCRIPSRi-v2 library top 5 sgRNAs/ gene (Horlbeck et al. 2016)(Addgene # 83969), was a gift from the Jonathan Weissman lab at UCSF ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Cell Biology 2023Quote: ... The FUCCI adenoviral vector was generated by cloning tFucci(CA)5 (Addgene plasmid #153521) into the pShuttle-CMV vector ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 5 OTp-hM3Dq-Myc (2.9 × 1012 gp/mL) (Corresponding plasmid: Addgene #184753)84
-
bioRxiv - Cell Biology 2023Quote: ... 5 x 106 HEK293T cells were co-transfected with 5μg psPAX2 (Addgene, Plasmid # 12260), 5μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... libraries with 5 sgRNAs per gene (mCRISPRi-v2; the “top5” library from Addgene #1000000092) or 10 sgRNAs per gene (hCRISPRi-v2 ...
-
bioRxiv - Cell Biology 2020Quote: ... MKL1/2 shRNA construct was obtained from Addgene (Lee et al., 2010). CAG:GFP construct was obtained from Cellomics Technology (PLV10057) ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794 ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Neuroscience 2020Quote: [2] QF2-Hsp70 from pattB-synaptobrevin-7-QFBDAD-hsp70 (Addgene plasmid #46115) (Primers ...
-
bioRxiv - Neuroscience 2020Quote: The pCMV4-FLAG-UBQLN2 plasmid (p4455 FLAG-hPLIC-2; Addgene plasmid # 8661) and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2 ng/μl RNase-free plasmid DNA (pX330, Addgene #42230) in a 15 ml Falcon tube ...
-
bioRxiv - Molecular Biology 2020Quote: 2 μl RNase-free plasmid DNA (pX330, Addgene #42230, 100 ng/μl),
-
bioRxiv - Bioengineering 2021Quote: We cloned the TRS-Leader-SARS-CoV-2-d2eGFP plasmid (Addgene 171585) by introducing 75 nt of the SARS-CoV-2 Leader sequence into the NheI-digested EFS-EGFPd2PEST-2A-Hygro plasmid (Addgene 138152) ...
-
bioRxiv - Biochemistry 2021Quote: The plasmid SARS-CoV-2 3xFlag-His-nsp5CS-nsp15 (Addgene ID: 169166) was used to express 3xFlag-His-nsp5CS-nsp15 in baculovirus-infected insect cells (Supplementary Table S1 and S2) ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV4-FLAG-UBQLN2 plasmid (p4455 FLAG-hPLIC-2; Addgene plasmid # 8661) and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1 ...
-
bioRxiv - Systems Biology 2021Quote: ... Ago2_KO1 mESCs were transfected with pX458-sgRNA_Ago1_1/2 (Addgene #73533 and #73534), and pX458-sgRNA_Ago1_3/4 (Addgene #73535 and #73536 ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Genetics 2021Quote: ... pLVX-EF1alpha-SARS-CoV-2-orf8-2xStrep-IRES-Puro (Addgene plasmid #141390). Orf8 deletion constructs were produced on the Orf8 backbone using Pfu Turbo HotStart DNA polymerase (Agilent 600322-51 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... β-arrestin 2 was amplifying from pCDNA3.1(+)-CMV-bArrestin2-TEV (Addgene #107245) with Gibson Assembly primers compatible with the NEBuilder HiFi DNA Assembly Kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... (2) sfGFP was amplified from template pHD-sfGFP Scareless dsRed (Addgene 80811) and (3 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ...
-
bioRxiv - Neuroscience 2021Quote: ... hSS were labeled with AAV-DJ-mDlx-GCaMP6f-Fishell-2 (Addgene, 83899) and placed in a well of a Corning 96-well microplate (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... (C1)2-GFP was a gift from Tobias Meyer (Addgene plasmid #21212) and RBD-GFP from Burridge lab ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) was injected 400 μm below the dura (4-10 sites ...
-
bioRxiv - Genetics 2020Quote: ... HUDEP-2 cells with stable expression of LentiCas9-Blast (Addgene plasmid 52962) were transduced at a low multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988, Addgene) using Lipofectamine 3000 (L3000001 ...
-
bioRxiv - Molecular Biology 2021Quote: pLVX-EF1alpha-SARS-CoV-2-Nsp1-2XStrep-IRES-Puro plasmid (Addgene, 141367) and pLVX-EF1alpha-SARS-CoV-2-Nsp2-2XStrep-IRES-Puro plasmid (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: Burrhole injections of viral constructs [rAAV2/1&2.hSyn.SIO-eOPN3-mScarlet (Addgene 125713 diluted to 6 × 1012 viral genomes/mL ...
-
bioRxiv - Microbiology 2023Quote: A plasmid encoding the SARS-CoV-2 Spike was obtained from Addgene #145032 ...