Labshake search
Citations for Addgene :
1151 - 1200 of 1381 citations for Recombinant Human ROR1 protein His tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Molecular Biology 2020Quote: The pooled Human GeCKO v2 CRISPR knockout plasmid library was a gift from Feng Zhang (41) and obtained from Addgene (#1000000048 and #1000000049). It is supplied as two sub-libraries ...
-
bioRxiv - Biochemistry 2021Quote: ... Pichia pastoris expression vector pPICZc carrying human β-actin fused with thymosin β4 and 6xHis-tag was a gift from Mohan Balasubramanian (Addgene #111146, RRID:Addgene_111146). β-Actin cDNA was mutated to introduce K50C and C374A for labeling with a cross-linking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: HT29 dCas9-VP64 clone E cells were transduced with lentivirus of Calabrese pooled human CRISPRa library set A and B (Addgene, 92379 and 92380) separately ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of human tau isoform 0N4R was subcloned into the pJFRC7 vector (Addgene, plasmid #26220. http://n2t.net/addgene:26220; RRID:Addgene_26220, a gift from Gerald Rubin43) to allow expression under the control of the GAL4/UAS system ...
-
bioRxiv - Cancer Biology 2024Quote: ... The construction of the two shRNA lentivirus vectors targeting the human β-catenin was performed following the Tet-pLKO Manual given by Addgene (plasmid#21915). The shRNA sequences used were the same as previously described (16) ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: The majority of the constructs used for expressing aggregating proteins were obtained from Addgene (Watertown, MA). The Addgene catalog numbers are as follows ...
-
bioRxiv - Biophysics 2019Quote: ... both proteins were expressed in HEK293T cells using a modified pTT5 expression vector (Addgene no. 44006), purified using StrepTactin beads (GE ...
-
bioRxiv - Cancer Biology 2020Quote: ... A plasmid expressing Green Fluorescent Protein (GFP) (pLJM1-EGFP was a gift from David Sabatini (Addgene plasmid # 19319 ...
-
bioRxiv - Cancer Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA encoding EGFP-LC3 fusion protein was released from pBABE-EGFP-LC3-puro (Addgene, #22405) and cloned into pQCXIN-EGFP-N1-Neo by the 5’-EcoRI and 3’-AgeI sites ...
-
bioRxiv - Systems Biology 2023Quote: Jurkat cells expressing dCas9-KRAB fusion protein were constructed by lentiviral delivery of pMH0006 (Addgene #135448) and FACS isolation of BFP-positive cells.
-
bioRxiv - Genomics 2022Quote: ... Protein A-MNase was expressed and purified from BL21(DE) carrying pET-pA-MN (Addgene: 86973).68–70
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... All clones for lentiviral vectors expressing the proteins described in this study are available from Addgene.
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Bioengineering 2023Quote: ... the protein coding sequence (CDS) of RLuc8.6 was amplified from pcDNA-RLuc8.6-53559 (Addgene ID 87125) and subcloned into the vector pRSETb115 (Addgene ID 89536 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell lines were transiently transfected with a membrane-targeted fluorescent protein (glycosylphosphatidylinositol-anchored eGFP, Addgene #32601) using a TransIT-X2 transfection kit (Mirus) ...
-
bioRxiv - Microbiology 2022Quote: ... a total of 300 million A549-Cas9 cells were then transduced with the lentiviral human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang)(29 ...
-
bioRxiv - Microbiology 2020Quote: ... a total of 240 million Huh7.5.1-Cas9-blast or Huh7.5.1-Cas9-blast+ACE2-IRES-TMPRSS2-hygro cells were transduced with lentivirus of the human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at a moi of 0.4 and subsequently selected using puromycin and expanded for 7 days ...
-
bioRxiv - Physiology 2020Quote: The human codon-optimized Cas9 and chimeric guide RNA expression plasmid (pX459v2) developed by the Zhang lab were obtained from Addgene (Cong et al., 2013). To generate gRNA plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid for tagging the N-terminus of the human lamin B1 gene (LMNB1) with RFP was purchased from Addgene (LMNB1-mTagRFP-T, #114403). The plasmid sequence was validated by Sanger sequencing.
-
bioRxiv - Microbiology 2022Quote: ... Dimeric human ACE2-IgG1 (hACE2) was generated by transfecting Expi293 cells with pcDNA3-sACE2-WT(732)-IgG129 (Addgene plasmid #154104, gift from Erik Procko) using 1 mg mL-1 PEI and then purifying from the supernatant five days post-transfection using rProtein A Sepharose (GE ...
-
bioRxiv - Neuroscience 2022Quote: ... the truncated human astrocyte-specific promoter hGfaABC1D (54) was digested from pAAV-GFAP-EGFP (donated by Dr. Bryan Roth, Addgene Plasmid #50473; RRID #Addgene_50473) and cloned into pAAV-EF1a-DIO-hM4D(Gi)-mCherry (donated by Dr ...
-
bioRxiv - Developmental Biology 2022Quote: ... a solution containing two sgRNAs (40 ng/μL each) and Cas9 protein (250 ng/μL) (Addgene; 47327) (Gagnon et al. ...
-
bioRxiv - Biochemistry 2021Quote: The ORAI1-yellow fluorescent protein (YFP) construct was purchased from Addgene (Cambridge, MA, USA; plasmid no. 19756). Site directed mutagenesis using the Pfu Turbo DNA polymerase from Agilent Technologies (Santa Clara ...
-
bioRxiv - Microbiology 2022Quote: ... with the exception that a 1872 bp region of pLifeAct_mScarlet-i_N1 (Bindels et al., 2017) (26.4 kDa LifeAct-mScarlet protein, Addgene) encompassing the CMV enhancer element ...
-
bioRxiv - Neuroscience 2020Quote: ... The control transmembrane protein PVRL3α was cloned into the mammalian expression vector pCAG-mGFP (Addgene, Cat#14757) to express the protein under the pCAG promoter (pCAG-PVRL3α) ...
-
bioRxiv - Biochemistry 2021Quote: ... Affinity precipitation of other RASSF proteins was done as above for RASSF5 using plasmids provided by Addgene RAS clone collection (RASSF1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... with a modification to include the 717 bp coding sequence for the EGFP protein (Addgene plasmid 26123). The number of genes captured and percentage transcripts of mitochondrial origin ...
-
bioRxiv - Neuroscience 2021Quote: ... retrograde AAV expressing enhanced blue fluorescent protein (EBFP) and Cre recombinase (AAVrg-pmSyn1-EBFP-cre, Addgene #51507) was injected into either NAc or RSC of Rosa26TdTomatoAi9 ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036; http://n2t.net/addgene:22036; RRID:Addgene_22036)) and VSV-G envelope (pMD2.G ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: ... fragments containing promoter and fusion protein segments were digested and cloned into the pKHR4 vector (Addgene #74592) using SpeI (NEB #R3133 ...
-
bioRxiv - Microbiology 2024Quote: ... envelope protein-expressing vector pCMV-VSVG (38) and the transfer vectors pEF1a-CAS9-2A-Blasticidin (#52962, Addgene) or pU6-gRNA-PGK-Puro-2A-BFP encoding CRISPR-Cas9 guide RNAs (gRNAs ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were co-transfected with plasmids encoding a mixture of viral packaging proteins VSV-G (12259, Addgene), viral backbone psPAX2 plasimd (12260 ...
-
bioRxiv - Cell Biology 2021Quote: ... .The KIF1C motor domain was replaced with full length human KIF1C fused to mCherry from pKIF1C-mCherry (available from Addgene 130978 (Theisen et al., 2012)) using NheI and BsrGI ...
-
bioRxiv - Microbiology 2020Quote: ... a total of 300 million Huh7.5.1-Cas9 cells were then separately transduced with the lentiviral gRNA sublibraries A and B of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) at a multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2021Quote: The RAS binding domain of C-RAF kinase (RAF-RBD) (Brtva et al., 1995) and full-length human RASSF5 from the RAS clone collection were obtained from Addgene (Raf1-RBD: #13338, RASSF5: #70545). The RAS clone collection was a gift from Dominic Esposito (Addgene kit 1000000070) ...
-
bioRxiv - Cell Biology 2022Quote: 6.0 × 10^6 BJAB clone B2 cells expressing both Cas9 and ERAAP dsRed were transduced with lentivirus of human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at an MOI of 0.4 using spin-infection (1,000 g for 2 h at 33 °C) ...
-
bioRxiv - Systems Biology 2022Quote: ... a total of 240 million A549-Cas9 cells were transduced with the lentivirus of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) (48 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cell Biology 2023Quote: The sequences encoding STIM1 and RspA-NFAST were amplified by PCR from respectively the human STIM1-YFP plasmid (Addgene #19754, a gift from A. Rao) and the pAG573 FRB-RspA(N)-IRES-mTurquoise214 plasmid ...