Labshake search
Citations for Addgene :
1101 - 1150 of 1381 citations for Recombinant Human ROR1 protein His tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336, #149334, #149333) (Pleiner et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Raf1 gRNA sequence derived from a 3rd generation lentiviral gRNA plasmid targeting human Raf1 (A gift from John Doench, David Root, Addgene plasmid #76708). Specifically ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid pX330 for expression of human-codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA were obtained from Addgene (Cambridge, MA). The seed sequence for the SpCas9 target site in the target gene was tcggtgcagaccacctcccgcgg (underline ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2019Quote: The cell line expressing a DELE1-mClover transgene line from the AAVS1 locus was generated by transfecting a cXG289 population in which ∼ 50% of cells expressed a DELE1-sgRNA and a BFP marker with pXG289 and TALENS targeting the human AAVS1 locus (AAVS1-TALEN_L/R, Addgene #59025 and #59026). Through FACS sorting ...
-
bioRxiv - Molecular Biology 2019Quote: ... The donor plasmid pAAVS1-TRE3G-NGN2 was constructed by replacing EGFP with human NGN2 in plasmid AAVS1-TRE3G-EGFP (Addgene plasmid # 52343). The donor plasmid pAAVS1-TRE3G-NGN2 (5 μg) ...
-
bioRxiv - Cell Biology 2020Quote: Human GeCKOv2 CRISPR knockout pooled library and lenti-Cas9-Blast was a gift from Feng Zhang (Addgene # 1000000049, (Sanjana et al., 2014)) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB (Uniprot Q9Y3I0) was inserted using ligation-independent cloning into the UC Berkeley MacroLab 438B vector (Addgene plasmid #55219) and DDX1 (Uniprot Q92499) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral vectors containing wild type and DNA-binding mutants of PRRX1 were generated by cloning cDNAs encoding full length or homeodomain deletions of the human PRRX1A sequence into the pInducer20 lentiviral plasmid (gift from Stephen Elledge, Addgene plasmid #44012). The DNA-binding mutants harbor individual deletions of the three α-helices (ΔH1 ...
-
bioRxiv - Microbiology 2020Quote: ... Guide sequences for IPPK and IPMK were obtained from the Human GeCKOv2 CRISPR knockout pooled libraries (a gift from Feng Zhang; Addgene #1000000048, #1000000049) [32] ...
-
bioRxiv - Immunology 2021Quote: ... The S106C mutant of human ASC PYD (aa1-106) was cloned into an in-house modified pET28-MBP-TEV vector (Addgene, plasmid #69929), in which N-terminal His6 tag was added for expression of proteins with a cleavable N-terminal His6-MBP-tag ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: The lentiviral gRNA and pre-gRNA expressing backbones were constructed by cloning the human U6 promoter and CasRx gRNA or pre-gRNA scaffold (Addgene #109053, #109054) into lentiGuide-Puro (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pX330 plasmid for expression of the human codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA was obtained from Addgene (Cambridge, MA). The seed sequences for the SpCas9 target site in target genes are shown in Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... were constructed by cloning the open reading frame (ORF) of human IRF1 or cMYC into a modified pLX303 vector (Addgene plasmid 25897). cDNAs encoding IRF1-SBDmut ...
-
bioRxiv - Genetics 2022Quote: ... in vitro transcription assays for human POU6F2 was performed using a reporter plasmid that encodes DsRed under a Hes5 promoter (Addgene, Cat# 26868). For POU6F2 expression vectors ...
-
bioRxiv - Neuroscience 2023Quote: ... A human Sirt3-RFP driven by the CaMKII promoter was constructed through PCR of the human Sirt3 sequence from Sirt3-FLAG (Addgene plasmid 13814)5 into the BamHI and AgeI sites of CaMKII-MICU3-RFP plasmid6 resulting in the linker sequence RPVVA joining Sirt3 and RFP sequences.
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Immunology 2023Quote: ... KO N/TERT keratinocytes were made and described in detail previously 27.MAP3K20 (ZAKα) KO human primary keratinocytes were generated using lentiviral Cas9 and guide RNA plasmid (LentiCRISPR-V2, Addgene plasmid #52961) using the following guides ...
-
bioRxiv - Neuroscience 2023Quote: ... A 10-sgRNA-per-gene CRISPR/Cas9 deletion library (Human CRISPR Knockout library was a gift from Michael Bassik (Addgene # 101926-101934)) was infected into Cas9-expressing U937 cells as described16 ...
-
bioRxiv - Genomics 2023Quote: ... The oligomer sequence was obtained from the data and the surrounding sequence was retrieved from the human STAP-seq screening vector sequence (Addgene ID: 125150). Both basepair level and TSS-level prediction and experimental measurements were compared ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... MCF-7 or HeLa single cell colonies were selected from cells transduced with the following sequences targeting human genes cloned into lentiCRISPR v2 (Addgene no. 52961):
-
bioRxiv - Neuroscience 2023Quote: ... and AAV encoding the cre-inducible excitatory designer receptor human M3 muscarinic receptor (hM3Dq; AAV2-Syn-DIO-hM3Dq-mCherry; Addgene, Watertown, MA) or fluorophore control (AAV2-Syn-DIO-mCherry ...
-
bioRxiv - Cell Biology 2023Quote: Donor plasmid encoding homology arms and linker-mEGFP sequence for C-terminus tagging of human NPM1 was designed by the Allen Institute for Cell Science and obtained from Addgene (AICSDP-50). The plasmid encoding NPM1-mEGFP was a gift from the Allen Institute for Cell Science (Addgene plasmid # 109122) ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Biophysics 2020Quote: ... final protein expression constructs were generated by Gateway LR recombination into pDest-566 (Addgene #11517), an Escherichia coli T7–based expression vector based on pET42 and incorporating hexa-histidine (His6 ...
-
bioRxiv - Biophysics 2022Quote: ... pET19b:EcMscLGFP was used previously as an in vitro membrane protein folding reporter (Addgene plasmid # 165097) (Jacobs et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression constructs for various cytoskeleton or organelle marker proteins were obtained from Addgene (S1 Table). For bacterial expression of His6-tagged CAHS proteins ...
-
bioRxiv - Cell Biology 2021Quote: MSCs were transduced with lentiviral particles having mitochondria targeting protein and GFP in downstream (Addgene) and lysosome were stained with lysotracker Deep-Red (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... an artificial transposon with all of the attributes of a protein expression vector (Addgene #120863), and 1 unit of MuA transposase (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...