Labshake search
Citations for Addgene :
1151 - 1200 of 1790 citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... diluted to 1/2) or AAV-Ef1a-mCherry (#114470-AAV9, obtained from Addgene; titer ...
-
bioRxiv - Genomics 2023Quote: ... and a “2 vector system” (backbone expresses only the sgRNA library – Addgene #73178). In this study we also used our Essential/Safe-havens library described above.
-
bioRxiv - Biochemistry 2023Quote: ... PDZ2 or PDZ1+2 tandem were obtained from Addgene (Tonikian et al., 2008) or purchased from GeneScript respectively and transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Genetics 2023Quote: ... 2 X 106 cells were co-transfected with 10 µg pT077 (Addgene 137879), 1.5 µg AAVS1 TALEN L (Addgene 59025 ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: mEos 2 Paxillin-22 was a gift from Michael Davidson (Addgene no, 57409).
-
bioRxiv - Synthetic Biology 2024Quote: ... we first obtained the CoV-2 genomic fragment from pSLQ5080_pHR_PGK_sfGFP_CoV-F2 (Addgene #155304) and then merged it into the 3’UTR of eGFP expression cascade in LPutopia-7 (Addgene #199212 ...
-
bioRxiv - Microbiology 2024Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175, https://www.addgene.org/42175/; RRID:Addgene_42175) as template and the HA-coding sequence was included in one of the primer to generate a C-terminally HA-tagged IGF2BP2 ...
-
bioRxiv - Neuroscience 2024Quote: AAV2/1-syn-GCaMP7s (Addgene 104487, 100–200 nl, 2 × 1013 GC / ml) was unilaterally injected into the MPOA of C57BL/6J mice using a Nanoject II or Nanoject III injector (Drummond Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and Illumina read 2 was generated from the plasmid pPEPZ-sgRNAclone (Addgene#141090) (de Bakker et al ...
-
bioRxiv - Neuroscience 2024Quote: ... using 2 x 1011 viral genomes of PHP.eB-CAG-FLEX-GFP (Addgene #5150270) per animal ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 µg of the SARS-CoV-2 Np coding plasmid (Addgene, cat.141391) was co-transfected as well ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of CROPseq-Guide-Puro (Addgene #86708) for 2 h at 37 °C with 2 ul of FastDigest Mph1103I (ThermoFisher cat ...
-
bioRxiv - Cancer Biology 2020Quote: pCFDg1-5 gRNA-tRNA array was constructed stepwise as previously described using pCFD5 (Addgene #73914)11 as a template and V8 targeting gRNAs.
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 5 μg of mEmerald-Kinesin11-N-18 plasmid (Addgene number: 54137) 24 hours prior to imaging ...
-
bioRxiv - Developmental Biology 2020Quote: ... into the HindIII/XbaI site 5’ of the Gateway cassette of pMpGWB401 (Addgene enry #68666). The reversely transcribed MpSUK1 locus (2.7kb ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448 ...
-
bioRxiv - Bioengineering 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (RRID:Addgene_17448)[33] ...
-
bioRxiv - Neuroscience 2024Quote: Intracerebroventricular injections of 5 μL of either AAV9-hSyn-DIO-hM3Dq-mCherry (Addgene # 44361-AAV9) (90 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) bilaterally into the lateral hypothalamus of the previously characterized and validated MCH-Cre mice42 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 µL of EnvA G-Deleted Rabies-mCherry (diluted 1:5 in dPBS; Addgene: 32636) was injected in the basal forebrain using the same coordinates ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Microbiology 2024Quote: ... pLenti PGK GFP Puro (w509-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19070 ...
-
bioRxiv - Neuroscience 2024Quote: ... while the Halo tag sequence was amplified from the TUBB-5 Halo plasmid (Addgene, #64691). These elements ...
-
bioRxiv - Biochemistry 2024Quote: ... blasticidin (Sigma-Aldrich, 5 μg/mL for four days; pLenti CMV Blast – Addgene plasmid #17451), or hygromycin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Molecular Biology 2021Quote: ... an XhoI restriction site was generated 5’ of the GFP-gene in pDRGFP (Addgene plasmid #26475)23 and the GFP-gene was replaced by the eBFP1.2 gene using the XhoI/NotI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were transduced with AAV9-Syn (5 x 109 gc per well) encoding jGCaMP8s (AddGene 162374) or CaBLAM (in house prep) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and guide cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D and sequenced to ensure authenticity before transferring to Agrobacterium.
-
bioRxiv - Cancer Biology 2023Quote: The sgRNAs specific for 5’ to the region of interest were cloned in pLentiCRISPRv2 (Addgene, #52961). sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Molecular Biology 2023Quote: ... Three clones with the correct insertion were transiently transfected with either 5 μg pFlpO (Addgene #13793) to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792 ...
-
bioRxiv - Neuroscience 2024Quote: ... The sgRNA target sequence: 5’-GCCGGCGAGCACTTTTATTG was cloned into the pU6-BbsI-chiRNA vector (Addgene, #45946). The vector for HDR contains the 5’ homology arm containing Shv genomic region (1000 base pairs at the 3’ end of the Shv gene with the stop codon removed ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 μg of transfer plasmid was co-transfected with 5 μg of pMD2.G (Addgene, #12259) and 7.5 μg of psPAX2 (Addgene ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 × 106 cells were co-transfected with 5 µg of eSpCas9-hGeminin plasmid (Addgene plasmid, #86613) and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... male mice first received bilateral injections of virus (AAV2/5-ef1α-FLEX-taCasp3-TEVp, Addgene, 45580) into the caudolateral PAG (day 0) ...
-
bioRxiv - Cancer Biology 2024Quote: ... AAV2 rep genes and adenovirus serotype 5 helper genes (gift from David Russell - Addgene plasmid #110660).62 Particles were harvested after 72 h ...
-
bioRxiv - Cell Biology 2020Quote: ... the pET30-2-GAPDH plasmids was a gift from David Sabatini (Addgene plasmid # 83910) (Pacold et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...