Labshake search
Citations for Addgene :
1101 - 1150 of 1790 citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Using the 3XFlag-pA-Tn5-Fl expression vector[2] (Addgene plasmid #124601), protein A sequence was replaced with an anti-GFP nanobody sequence that was PCR amplified from the pGEX6P1-GFP-Nanobody vector [30] (Addgene plasmid #61838 ...
-
bioRxiv - Genetics 2024Quote: ... was constructed by replacing the dU6:2 promoter from pLib6.4 (Addgene #133783) with the dU6:3 promoter from pCFD3 (Addgene #49410 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: mRFP-FKBP-5-ptase-dom and PM-FRB-CFP plasmids were obtained from Addgene (deposited by the laboratory of T ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl cold lysisg/μl cold lysisl pCAGG>nls-hCas9-nls-GFP (Addgene #99141) and 3 μl cold lysisg/μl cold lysisl U6.3>Lhx5/Sox1/Six3 gRNA f+e was microinjected together with the Fast Green solution (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the sequence of Francisella novicida cas12a was amplified from pUDC175 (Addgene plasmid #103019, (5)) using primers 13553-13554 ...
-
bioRxiv - Molecular Biology 2020Quote: The hCRIPSRi-v2 library top 5 sgRNAs/ gene (Horlbeck et al. 2016)(Addgene # 83969), was a gift from the Jonathan Weissman lab at UCSF ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Cancer Biology 2024Quote: ... libraries with 5 sgRNAs per gene (mCRISPRi-v2; the “top5” library from Addgene #1000000092) or 10 sgRNAs per gene (hCRISPRi-v2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 x 106 HEK293T cells were co-transfected with 5μg psPAX2 (Addgene, Plasmid # 12260), 5μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The FUCCI adenoviral vector was generated by cloning tFucci(CA)5 (Addgene plasmid #153521) into the pShuttle-CMV vector ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (gifted from Melina Fan [Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964]), pAAV2/7 (gifted from James M ...
-
bioRxiv - Immunology 2024Quote: ... Two BA.5 NTD DMS libraries were further assembled into pETcon 2649 vector (Addgene) and electroporated into electrocompetent DH10B cells for plasmid amplification ...
-
bioRxiv - Neuroscience 2024Quote: ... a backbone plasmid of pLV.PARP1#5 (a gift from Didier Trono - Addgene plasmid # 14548), to produce pLV.Usp14shRNA ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μg of pMD2.G envelope plasmid (Addgene #12259, generated in Dr Trono’s lab) and 2.5 μg of pRSV-Rev plasmid (Addgene #12253 ...
-
bioRxiv - Cancer Biology 2024Quote: 10 µg of the expression plasmid and 5 µg pCL-Eco (Addgene plasmid #12371) were co- transfected into Pheonix-Eco cells in the culture medium without antibiotics ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of CROPseq-Guide-Puro (Addgene #86708) for 2 h at 37 °C with 2 ul of FastDigest Mph1103I (ThermoFisher cat ...
-
bioRxiv - Cancer Biology 2020Quote: pCFDg1-5 gRNA-tRNA array was constructed stepwise as previously described using pCFD5 (Addgene #73914)11 as a template and V8 targeting gRNAs.
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 5 μg of mEmerald-Kinesin11-N-18 plasmid (Addgene number: 54137) 24 hours prior to imaging ...
-
bioRxiv - Developmental Biology 2020Quote: ... into the HindIII/XbaI site 5’ of the Gateway cassette of pMpGWB401 (Addgene enry #68666). The reversely transcribed MpSUK1 locus (2.7kb ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) bilaterally into the lateral hypothalamus of the previously characterized and validated MCH-Cre mice42 ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Bioengineering 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (RRID:Addgene_17448)[33] ...
-
bioRxiv - Neuroscience 2024Quote: Intracerebroventricular injections of 5 μL of either AAV9-hSyn-DIO-hM3Dq-mCherry (Addgene # 44361-AAV9) (90 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 µL of EnvA G-Deleted Rabies-mCherry (diluted 1:5 in dPBS; Addgene: 32636) was injected in the basal forebrain using the same coordinates ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448 ...
-
bioRxiv - Neuroscience 2024Quote: ... while the Halo tag sequence was amplified from the TUBB-5 Halo plasmid (Addgene, #64691). These elements ...
-
bioRxiv - Microbiology 2024Quote: ... pLenti PGK GFP Puro (w509-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19070 ...
-
bioRxiv - Biochemistry 2024Quote: ... blasticidin (Sigma-Aldrich, 5 μg/mL for four days; pLenti CMV Blast – Addgene plasmid #17451), or hygromycin (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2020Quote: ... and a kanamycin resistance (from the plasmid pBBR1MCS-2 (55) purchased from Addgene 85168) ...
-
bioRxiv - Genetics 2021Quote: ... daf-16 (#34833) and daf-2 RNAi (#34834) clones were obtained from Addgene. mbl-1 RNAi was cloned from C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259)) mixed in 0.45 mL water ...
-
bioRxiv - Cell Biology 2022Quote: ... pmTurquoise2-Golgi was a gift from Dorus Gadella (Addgene plasmid # 36 2 05)32 ...
-
bioRxiv - Cancer Biology 2021Quote: ... annealed in vitro and subcloned into BsmbI-digested lentiCRISPRv.2-puro (Addgene 52961) or lentiCas9-Blast (ULK2 sgRNAs ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... , (2) nlsLexA::GADfl ORF was amplified from pBPnlsLexA::GADflUw (Gerald Rubin54, Addgene-26232), and (3 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Pmyo-2::mCherry co-injection marker (2.5 ng/μl; pCFJ90, Addgene #19327) were micro-injected in the gonad of young adults ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... annealed in vitro and subcloned into BsmbI-digested lentiCRISPRv.2-puro (Addgene 52961) or lentiCRISPRv.2-hygro (Addgene 98291) ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Cell Biology 2022Quote: ... Number of pulses: 2×106 cells were transfected with ING2-PHD_GFP (Addgene, #21589) or pCSDEST2_NLS-GFP (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT Δ(2-15)-3F pCW57.1 was generated using the pCW57.1 (Addgene, #41393) plasmid backbone ...
-
bioRxiv - Neuroscience 2021Quote: ... 500–550 nl of AAV9-Syn-jGCaMP7f-WPRE virus (diluted 1:2; Addgene) was injected in dorsal CA1 to express synapsin-driven calcium sensor jGCaMP7f (injection coordinates ...