Labshake search
Citations for Addgene :
1101 - 1150 of 1174 citations for 7 Bromo 5 fluoro 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were infected at 5 days in vitro (DIV) with titer-matched viruses using pAAV-Syn-ChrimsonR-tdT (Addgene #59171) and pAAV2.5-TH-GFP (Addgene #80336) ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsDNA repair templates were amplified using primers with 5’ SP9 modifications (IDT) from the pJRK86 plasmid (AID*::GFP, Addgene #173743) and mIAA7 repair template plasmids in table 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Figs. 4A-C, 5, and 7B,C, and Supplementary Movies 1,2; Salk Vector Core; 2.5 x 1012; Addgene plasmid #50973); AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 nM or 37.5 nM of preincubated binary complexes were added to 5 nM of target DNA (eGFP-hAgo2 plasmid (Addgene #21981) linearized with SmaI) ...
-
bioRxiv - Neuroscience 2022Quote: ... For the chemogenetic activation of 5-HT2cR we used AAV8-hSyn-DIO-hMD3q-mCherry and AAV8-hSyn-DIO-mCherry (UNC, Addgene). For the silencing of GLP1R mRNA we used AAV1.U6.shRGlp1r07.CB7.EGFP.SV40 (AAV1-shRNA-Glp1r ...
-
bioRxiv - Developmental Biology 2022Quote: ... The empty ctrl or MMP14-eGFP lentiviral plasmid (7.5 μg) was co-transfected into 293 cells with packaging plasmid pRSV-Rev (5 μg, Addgene #12253), pMDLg/pRRE (2.5 μg ...
-
bioRxiv - Neuroscience 2019Quote: In some PV-IRES-Cre mice ChR2 was introduced by injecting 50 nL of AAV2/5-hSyn1-FLEX-hChR2-tdTomato (Addgene plasmid 41015 ...
-
bioRxiv - Neuroscience 2021Quote: Cre-dependent adeno-associated virus (AAV; serotypes 5 or 9) was used to express GCaMP6s (AAV5-Syn-Flex-GCaMP6s, Addgene), or GCaMP7f (AAV9-Syn-Flex-jGCaMP7f-WPRE ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Microbiology 2020Quote: The nucleic acid sequences of N-terminal adhesin domains of CfaE and class 5 adhesins (GenBank M55661) were cloned into a pMAL-C5X vector (Addgene) in-frame with an MBP tag to express as periplasmic proteins with improved solubility (MBP–CfaE-N) ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448; http://n2t.net/addgene:17448; RRID: Addgene 17448) (40) ...
-
bioRxiv - Microbiology 2023Quote: ... The second 5’-HDNT allele was replaced by a similar puromycin cassette (puro-HSV-TK-loxP) amplified from the pHJ18 plasmid (Addgene) [65] using primers p47/p48 ...
-
bioRxiv - Neuroscience 2023Quote: ... Ntsr1-Cre and Rbp4-Cre mice were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” ...
-
bioRxiv - Cell Biology 2023Quote: ... A pair of 20-mer oligonucleotides targeting the 5’ end of the dtat coding sequence was ligated into pAc-sgRNA-Cas9 (Addgene) and validated by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 5; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Neuroscience 2024Quote: ... pegRNA plasmids for prime editing were cloned by ligating annealed oligonucleotide pairs (Supplemental table 5) into the BsaI-digested pU6-peg-GG-acceptor (pU6-pegRNA-GG-acceptor was a gift from David Liu. Addgene #132777 ...
-
bioRxiv - Neuroscience 2024Quote: ... were cloned by ligating annealed oligonucleotide pairs (Supplemental table 5) into the BsmBI-digested pBPK1520 plasmid (BPK1520 was a gift from Keith Joung. Addgene#65777 ...
-
bioRxiv - Neuroscience 2024Quote: ... Rats then received bilateral infusions of either AAV8-CAMKIIa-hM3D(Gq)-mCherry or AAV8-CaMKIIa-GFP (5×1012 vg/mL for both viruses; Addgene) into the VH (either A/P ...
-
bioRxiv - Neuroscience 2024Quote: ... PV-Cre mice (N = 5) were injected at the same coordinates with 250 nL of AAV-ef1a-Flex-iChloC-2A-dsRed (Addgene plasmid ...
-
bioRxiv - Molecular Biology 2019Quote: ... were cloned via BpiI into pX330S-2 and pX330S-3 (Sakuma et al., 2014) and a third vector pGEP179_pX330K (this study) according to kit instructions (Addgene Kit#1000000055, Sakuma et al., 2014). The pGEP179_pX330K plasmid is a modified entry vector generated by cloning the BsaI-pU6-sgRNA-BsaI fragment from pX330A-1×3 (Sakuma et ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... IFT121 and IFT139 in IMCD-3 cells were designed using Benchling software and cloned into the pX330 vector (gift from Feng Zhang; Addgene plasmid # 42230; (Cong et al., 2013)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
bioRxiv - Cell Biology 2020Quote: ... using primer sequences 5’-TGTACCGGTCTCGAGGCCACCAT-GGTGGGTGAGG and 5’-AGATCCGGAGCTGTG-CCCCAGTTTGCTA, and cloned in place of EGFP in pT7-EGFP-C1-HsDCP1a (Tritschler et al., 2009) (Addgene # 25030). We then excised the FP635-DC-P1a cassette and blunt cloned into d2EGFPβ-glo-bin-UTR in place of the d2EGFP coding region.
-
bioRxiv - Molecular Biology 2020Quote: ... All cell lines used to assess mitotic progression (Figures 5 and S7) were generated by co-transfecting pcDNA3 encoding mCherry-tagged Histone H2B (Addgene: 20972) and pcDNA3 encoding GFP-tagged Lamin B1 (a kind gift from David Vaux) ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN glia AAV-5: pZac2.1 gfaABC1D-cyto-GCaMP6f at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Developmental Biology 2019Quote: ... Oligonucleotides encoding sgRNA protospacer sequences (Extended Data Table 5) were annealed and cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang, Addgene plasmid # 42230) as described previously47 ...
-
bioRxiv - Cell Biology 2019Quote: ... The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397) as a gift from David Liu [31] ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 sgRNAs targeting DIS3L2 (generated using the ChopChop tool (Labun et al., 2019)) were cloned into lentiGuide-Puro (Addgene #52963). The individual sgRNAs were subsequently transduced into MCF10a cells stably expressing pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911 ...
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Cell Biology 2022Quote: ... a 20bp guide sequence targeting the 5’ end of WNK1 exon 1 was ligated to the BbsI site of PX459 (Addgene #62988). In addition ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Developmental Biology 2022Quote: ... Lentiviruses delivering sgRNA were packed by transfecting about 70% confluent HEK293T cells cultured in T75 flasks with 5 µg pCMV-VSVG (Addgene 8454), 10 µg pCMV-dR8.2 dvpr (Addgene 8455) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Microbiology 2021Quote: Design of the guide RNA targeting the region between Dicer 5’-UTR and its first coding exon for CRISPR/Cas9 mediated knock-in was carried out using the CRISPOR Design Tool [86]. Annealed oligonucleotide corresponding to the gRNA (Supp. Table 5) were cloned into the vector pX459 (Addgene #48139) which also encodes S ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.5 million cells were resuspended in Mirus nucleofector solution and electroporated with 5 ug of px458 plasmid (Addgene plasmid #48138) containing a small guide RNA (see Table S1 for oligonucleotide information ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Plant Biology 2023Quote: ... and MOM1 CMM2 domain (aa1660-aa1860)5 were first cloned into gateway entry vectors followed by LR reaction with pGBKT7-GW (Addgene 61703) and pGADT7-GW (Addgene 61702 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2014) AAV2-hSyn-DIO-hM4D(Gi)- mCherry vector (titer ≥ 5×10¹² vg/mL) was attained from AddGene (catalog number 44362-AAV2). Rats were anesthetized with 2.5% isoflurane ...
-
bioRxiv - Neuroscience 2023Quote: ... were coated with 200 nL of a 1:1 mixture of 5% silk fibers and AAV9.CaMKII.GCaMP6f.WPRE.SV40 (Addgene viral prep # 100834-AAV9), as previously described by 70 ...