Labshake search
Citations for Addgene :
851 - 900 of 1174 citations for 7 Bromo 5 fluoro 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was injected into worms along with a plasmid containing transposase (pCFJ601, Peft-3::Mos1 transposase, Addgene #34874) and co-injection markers (pGH8 Addgene #19359 ...
-
bioRxiv - Genetics 2023Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722 ...
-
bioRxiv - Genetics 2023Quote: ... and a 3’ UTR harboring the WPRE element was cloned in the pT7-PEmax for IVT plasmid (Addgene 178113)2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542; http://n2t.net/addgene:62542; RRID: Addgene_62542). 250 ng/μl of Cas9 mRNA and 50 ng/μl of gRNA(s ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3.7 μg pLenti6.3-HA-NL-tetraspanin plasmids or pLenti6.3-CD63-pHluorin plasmid were co-transfected with 0.9 μg pREV (Addgene, 12253) and 1.8 μg pRRE (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of CROPseq-Guide-Puro (Addgene #86708) for 2 h at 37 °C with 2 ul of FastDigest Mph1103I (ThermoFisher cat ...
-
bioRxiv - Cancer Biology 2020Quote: pCFDg1-5 gRNA-tRNA array was constructed stepwise as previously described using pCFD5 (Addgene #73914)11 as a template and V8 targeting gRNAs.
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 5 μg of mEmerald-Kinesin11-N-18 plasmid (Addgene number: 54137) 24 hours prior to imaging ...
-
bioRxiv - Developmental Biology 2020Quote: ... into the HindIII/XbaI site 5’ of the Gateway cassette of pMpGWB401 (Addgene enry #68666). The reversely transcribed MpSUK1 locus (2.7kb ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448 ...
-
bioRxiv - Bioengineering 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (RRID:Addgene_17448)[33] ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) bilaterally into the lateral hypothalamus of the previously characterized and validated MCH-Cre mice42 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 µL of EnvA G-Deleted Rabies-mCherry (diluted 1:5 in dPBS; Addgene: 32636) was injected in the basal forebrain using the same coordinates ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Neuroscience 2024Quote: Intracerebroventricular injections of 5 μL of either AAV9-hSyn-DIO-hM3Dq-mCherry (Addgene # 44361-AAV9) (90 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
Cytonemes coordinate asymmetric signaling and organization in the Drosophila muscle progenitor nichebioRxiv - Developmental Biology 2022Quote: ... The T2A-nls:Gal4:VP16-STOP sequence was generated by PCR (Supplementary Table 3) from the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB vector (Addgene). 5’HA-T2A-nls:Gal4:VP16-STOP-3’HA was assembled in correct 5’-to-3’ order between Not1 and EcoR1 sites of the pJet1.2 vector.
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Molecular Biology 2019Quote: ... sgRNAs that target the 3′ end of the respective coding sequences were cloned into hSpCas9 plasmid (PX458, Addgene Plasmid #48138) (Ran et al ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Microbiology 2022Quote: C-terminal endogenous tagging of loci was performed in TgPRUΔKu80ΔHXGPRT by targeting the 3’UTR of ROCY1 with a specific gRNA cloned into the pUniversal-CAS9 plasmid (Addgene #52694) and then co-transfected with a homology repair cassette amplified from the pLIC-HXGPRT plasmid (as outlined in (Fox et al. ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... eft-3::hpo-9 or BTBD9 alone were co-injected into tm3719 strain with pG2M36 (myo-3::dsRed) and pBCN27-R4R3 (rpl-28::PuroR, Addgene), which were used as the selective markers for transformation ...
-
bioRxiv - Genomics 2022Quote: ... 12 μg of plasmid library was cotransfected with 9 μg psPAX2 and 3 μg pMD2.G (Addgene #12260 and #12259) into HEK293FT cells using 72 μl Lipofectamine 2000 (Life Technologies #11668019) ...
-
bioRxiv - Neuroscience 2019Quote: ... The intracellular solution also contained 50 µM of the red fluorescent dye AlexaFluo 594 and 3 plasmids with the following concentrations42: 100µg/µL pCAG-dsRed2 (Addgene #15777), 200 µg/µL pCMV-oG48 (Addgene 74288 ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Cancer Biology 2019Quote: ... SENP8) clonal Cas9 expressing BC-3 cells were transduced with lentiviral sgRNA vectors based on pLenti-guide puro (Addgene #52963)34 ...
-
bioRxiv - Synthetic Biology 2019Quote: All single guide RNAs were cloned in BbsI-linearized pCFD3-dU6:3 gRNA plasmid (a gift from Simon Bullock; Addgene plasmid # 49410 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The CRISPR line robo1ΔWIRS was generated by cloning a guide targeting the WIRS motif into a pCFD3-dU6:3 backbone (Addgene, #49410) and sending positive clones to BestGene Inc ...
-
bioRxiv - Molecular Biology 2019Quote: ... was chosen to target the TIP5 locus on exon 3 three base pairs upstream of the ATG start codon and was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene). This plasmid was co-transfected with the HDR repair template plasmid containing the FLAG/HA inclusion flanked by 1kb homology arms into wild type ESCs at a molar ratio of 1:3 ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Genetics 2019Quote: ... Only a single site upstream of the c(3)GccΔ1 deletion was selected (AAAGCTTTGTTGGCCTGTATTGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense (CTTCGAAAGCTTTGTTGGCCTCTAT ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Cell Biology 2019Quote: ... The guide RNA sequences used to generate TDP43 KO cell lines (summarized in Supplemental Table 3) were annealed and cloned into the BbsI site of pSpCas9(BB)-2A-Puro vector (px459, Feng Zhang, Addgene). Sub-confluent Hela cells were transfected with 1µg of px459 vector using FuGENE 6 (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: Using the Neon transfection system pre-set program #16 (1400V, 20ms, 3 pulses) plasmids used for reprogramming (available from Addgene) were EN2L ...
-
bioRxiv - Genetics 2020Quote: ... Plasmids generated for this work for heat shock Cas9 expression (pJJF152) and proof of concept sgRNAs (targeting SECGFP, dpy-10, sqt-3) will be available from Addgene as indicated in a supplementary table or for specific sgRNAs upon direct request from the authors.
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig. 2F,G and Supplementary Movie 3; Vigene Biosciences; 2.5 x 1012; Addgene plasmid #105677); AAV1-hSyn-DIO-TVA66T-tdTomato-CVS-N2cG (Fig ...
-
bioRxiv - Developmental Biology 2021Quote: ... gRNAs targeting exon 3 of the zebrafish atg13 orthologue (Ensembl: ENSDART00000052324.6; zgc:63526) were cloned into the pT7-gRNA plasmid (Addgene #46759) and generated according to Jao et al ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...