Labshake search
Citations for Addgene :
1101 - 1150 of 1387 citations for 4 Chloro 2 methoxy N 2 4 methoxy phenyl ethyl benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Each transfection consisted of 250 ng expression plasmid (pcDNA3-control (Addgene; n/a), pcDNA3-Sox2FLAG (homemad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234 ...
-
bioRxiv - Biophysics 2021Quote: ... was a gift from Michael Davidson (mApple-MAPTau-N-10, Addgene plasmid # 54925). Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected overnight in 10cm plates with N-GFP-RelA (Addgene #23255) or C-Flag-Rela (Addgene #20012 ...
-
bioRxiv - Cell Biology 2020Quote: mRuby2-MannII-N-10 was a gift from Michael Davidson (Addgene plasmid # 55903)(83) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... a chimeric coding sequence consisting of an N’-terminal HiBit (pEPYC0CM0258, Addgene T.B.C.) the uidA coding sequence ...
-
bioRxiv - Genetics 2020Quote: ... Dapi labelled the nuclei and m-Cherry-TNGP-N-10 (Addgene, Cat # 55145) localized the Golgi ...
-
bioRxiv - Cell Biology 2022Quote: ... The MAP4K4 sequence was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentiviral plasmid using the gateway system ...
-
bioRxiv - Microbiology 2023Quote: ... The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene) with primers HCoV-OC43-N c-opt(pLVX)_Fw (gaattcgccgccaccatgtccttcaccccggg ...
-
bioRxiv - Microbiology 2023Quote: ... The LMP1 coding region was amplified from MSCV-N LMP1131 (Addgene plasmid #37962) and cloned into pRetroX-IRES-ZsGreen via Gibson Assembly ...
-
bioRxiv - Biochemistry 2024Quote: USP2 with an N-terminal His-tag was purchased from Addgene (plasmid #36894). AMSH* ...
-
bioRxiv - Cell Biology 2022Quote: ... with AgeI and BstBI restriction sites into the pLenti CMV/TO GFP-MDC1 (779-2) (plasmid #26285, Addgene, gift from E. Campeau; Genewiz) backbone ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Cancer Biology 2020Quote: pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines were obtained upon transfection of the SAOS 2 cell line with the plasmids pBABE-puro or pBABE-puro-hTERT from Addgene (#1764, #1771, respectively), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines presented in this study are available from the corresponding author upon request and all plasmids are available from Addgene (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660), the lentiviral expression plasmid ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Cell Biology 2024Quote: ... was amplified and inserted by In-Fusion cloning between myo-2 promoter driving mCherry and unc-54 3’UTR of pCFJ90 (Addgene #19327; Watertown, MA) to generate plasmid pKM3 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pMXs-Hu-N-Myc and pMXs-Hu-L-Myc plasmids were obtained from Addgene. The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pDEST-CMV-N-mCherry was a gift from Robin Ketteler (Addgene plasmid # 123215) (Agrotis ...
-
bioRxiv - Neuroscience 2021Quote: ... and tTA from pAAV::TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene #92392) by the conventional PCR reactions ...
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were AAV5-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene plasmid #92392), AAV5-M13-TEV-C-P2A-tdTomato (Addgene plasmid #92391) ...
-
bioRxiv - Biochemistry 2021Quote: ... and pGAT2 (N-terminal polyhistidine and GST tags; Addgene #112588; last three genes (61)) by Twist Bioscience ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLVU/GFP and pLEX_305-N-dTAG lentiviral plasmid vectors were from Addgene (#24177, #91797). pHTN HaloTag CMV-neo and pHTC HaloTag CMV-neo vectors were from Promega (G7721 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received infusions of 500 nL of AAV5-hsyn-ChR2-eYFP (n= 22; Addgene 26973 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plasmid px330- BbsI-PITCh UPF1 N is based on pX330-BbsI-PITCh (Addgene plasmid #127875 ...
-
bioRxiv - Biochemistry 2024Quote: ... The DNA sequence of SLC45A4 was cloned to pLPC-N FLAG vector (Addgene, 12521) using BamHI-HF (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... we performed a Gateway LR reaction with pENTR223_KRASG12V and pLEX305-N-dTAG (Addgene #91797), according to manufacturer’s protocol.
-
bioRxiv - Biochemistry 2024Quote: ... with an N-terminal His-tag was purchased from Addgene (pOPINB-AMSH*, plasmid #66712). SHMT2ΔN(A285T ...
-
bioRxiv - Microbiology 2021Quote: ... the open reading frame was amplified by PCR from the pDONR223 SARS-CoV-2 NSP5 plasmid (Addgene, #141259, a gift from Fritz Roth [32]), including an ATG start codon in the forward primer and a TAA stop codon in the reverse primer (MPro_Fw ...
-
bioRxiv - Immunology 2020Quote: ... pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-SARS-CoV-2-S-RBD-sfGFP plasmids were gifts from Erik Procko (Addgene plasmids #145163 and #141184). pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Neuroscience 2023Quote: ... Michael Ward and the 2 CLYBL targeting TALEN plasmids (pZT-C13-R1 and pZT-C13-L1, gifts from Jizhong Zou Addgene.org: #52638 and 52637, respectively) by the same method with the Neon Transfection System (40) ...
-
bioRxiv - Neuroscience 2023Quote: Foreskin fibroblasts were transfected with the AAVS1-DOX-KRAB-dCAS9 plasmid and the 2 AAVS1 Talen plasmids (Gifts from Danwei Huangfu, Addgene plasmid # 59025 and 59026) using the Neon Transfection system (38) ...
-
bioRxiv - Cell Biology 2024Quote: ... The FAP-tagging plasmids and those expressing these FAP-tagged cellular markers are all available on Addgene (see Supplemental Table 2 or Addgene global deposit number 84326). Plasmids were transformed into yeast cells using the lithium acetate method (Ausubel ...
-
bioRxiv - Cell Biology 2020Quote: P4M-GFP and mApple-Talin-N-10 were obtained from Addgene (51469 and 54951 respectively). FAPP-GFP was a gift from Tamas Balla ...
-
bioRxiv - Cell Biology 2020Quote: ... mEmerald-N-Wasp-C-18 and mEmerald-Coronin1B from Michael Davidson (Addgene plasmids #54199, 54050), pmCherry-C1-WIP from Anna Huttenlocher ...
-
bioRxiv - Cancer Biology 2020Quote: ... HPV16 E6 (p6661 MSCV-IP N-HA only 16E6 – Addgene plasmid # 42603 Dr. Peter Howley), HPV16 E7 (p6640 MSCV-P C-FlagHA 16E7-Kozak - Addgene plasmid # 35018 – Dr ...
-
bioRxiv - Biochemistry 2021Quote: ... pRSF-1-NMT for expression of N-myristoyl transferase in bacteria was purchased from Addgene.