Labshake search
Citations for Addgene :
851 - 900 of 1387 citations for 4 Chloro 2 methoxy N 2 4 methoxy phenyl ethyl benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Mu-opioid receptor activation potentiates excitatory transmission at the habenulo-peduncular synapsebioRxiv - Neuroscience 2024Quote: ... bilateral injections (150 nl/ hemisphere) of AAV5-EF1a-DIO-ChR2:mCherry (2-2.5 x 1013 gc/ml, Addgene 20297) were made into MHb ...
-
bioRxiv - Biochemistry 2024Quote: ... pLKO.1 puro CXCR4 siRNA-1 and siRNA-2 were gifts from Bob Weinberg (Addgene plasmids #12271 and #12272). plKO.1 scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864) ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Neuroscience 2024Quote: ... For optogentic activation of the glutamatergic PPN in Figure 3S: AAV5-Ef1a-DIO-hChR2-(E123T/T159C)-eYFP-WPRE was injected into the PPN (Addgene, 35509-AAV5, 4×10e12). For chemogenetic experiments in Figure 4 and 4S ...
-
bioRxiv - Immunology 2023Quote: ... N-MLV reporter viruses were generated by transfection of a three-plasmid system: pCIG3-N for expression N-MLV gag/pol (Addgene #132941, a gift from Jeremy Luban) [50] ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Immunology 2021Quote: ... or 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: ... full name AAV-EF1a-DIO-trkB.DN-TM570-mCherry (Addgene, n°121502), was constructed by PCR amplification of rat truncated trkB.T1 with the sequence downstream of the transmembrane domain replaced by the sequence of three alanine residues followed by a stop codon (from the plasmid pLTM570 ...
-
bioRxiv - Microbiology 2021Quote: ... a pHAGE N-mNeonGreen IRES puro was also generated (Addgene #170467).
-
bioRxiv - Cell Biology 2022Quote: ... N-terminal IBAR genes were cloned into Cry2PHR-mCherry (Addgene #26866) using NheI and XhoI restriction sites (Kennedy et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-hSynapsin1::NAPA-N SV40 (gift from Baljit Khakh, Addgene #92282) (titer ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mApple-MyosinIIA-N-18 (Addgene #54930, gift from Michael Davidson), and pEGFP internal GFP Ezrin (gift from Florence Niedergang).
-
bioRxiv - Cell Biology 2020Quote: ... and mCherry-Cx43-N-7 were gifts from Michael Davidson (Addgene plasmids # 55112 ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2022Quote: ... construct was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentivirus plasmid using the gateway system (ATTB sites were added at the Paxillin-peGFP plasmid using the primers ...
-
bioRxiv - Molecular Biology 2023Quote: N-terminal histidine tagged wild-type VCP was obtained from Addgene (plasmid #12373 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLVpuro-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122848 ...
-
bioRxiv - Biochemistry 2023Quote: ... or N-terminal His10-MBP Tag (2CT-10; Addgene Plasmid #37237) were chosen as the MBP tag has been shown to increase the solubility of select proteins [9] ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Biochemistry 2023Quote: ... pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-FilaminA-N-9 (Addgene #55047, gift from Michael Davidson), pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ad-mApple-TOMM20 derived from mApple-TOMM20-N-10 (Addgene #54955), Ad-EGFP-BNIP3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we initially electroporated with a pCAGGS-mCherry plasmid (Addgene n°41583) in CNC or TNC cells at 7ss and 14ss ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gene sequences encoding N-terminally mCherry tagged Drp1 (Addgene, 49152) were inserted between the EcoRI and PstI sites of the pCDNA vector (mCherry-Drp1) ...
-
bioRxiv - Neuroscience 2024Quote: ... pGW-HA.attB 37 or pDEST-CMV-N-EGFP (Addgene Plasmid #122842) respectively using the Gateway LR Clonase reaction (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No. NR-52310: BEI Resources) or VSV-G (a gift from Tannishtha Reya (Addgene plasmid # 14888 ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Cell Biology 2020Quote: Two previously described sgRNAs specific to the Kap1 gene10 (Supplementary Table 2) were incorporated into plentiGuide-puro vector (Addgene #52963). For production of lentiviral particles ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Microbiology 2021Quote: ... pEZY-FLAG-Nsp14 vector was constructed from pDONR223 SARS-CoV-2 Nsp14 vector to the pEZY-FLAG (Cat # 18700, Addgene) destined vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... and gGene-N2a and gGene-N2b for Nickase 2) cloned into tandem U6 cassettes in a version of pX330 plasmid (pX330-U6-Chimeric_BB-CBh-hSpCas9, Addgene #42230) mutated to express Cas9D10A-T2A-GFP (Nickase-1/2) ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Biophysics 2022Quote: Live cell Mpro proteolytic cleavage activity assays were performed by co-transfecting HEK 293T cells with either the pmNG-Mpro-Nter-auto-NLuc or the pmNG-Mpro-Nter-auto-L-NLuc Mpro sensor plasmid constructs along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Genetics 2020Quote: Prime Editor 2 (PE2) plasmid coding for the SpCas9 gene fused with the MLV reverse transcriptase was obtained from Addgene Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Biochemistry 2021Quote: ... PINK1 and PARKIN (Supplemental Table 2) were designed using CRISPOR.org14 and inserted into LentiCRISPRv2 plasmid15,16 (a gift from Feng Zhang (Addgene plasmid # 52961), as done before7 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Expi293F cells were transfected with pcDNA3-SARS-CoV-2-S-RBD-sfGFP (a gift from Erik Procko, Addgene plasmid # 141184) using ExpiFectamine™ 293 Transfection Kit according to manufacturer’s directions (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: The human codon-optimized CAS9 with 2×35S CaMV promoter and Nos terminator was amplified from pAGM4723 plasmid (Addgene# 49772) using KpnI forward and PacI reverse primers (Supplemental Table 9) ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Biophysics 2022Quote: ... RRID:Addgene_141370)85or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...