Labshake search
Citations for Addgene :
1101 - 1150 of 1731 citations for 1 Methoxy 4 1 methylbutyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... pCSII-EF-miRFP670v1-hGem(1/110) was a gift from Vladislav Verkhusha (Addgene plasmid # 80006; http://n2t.net/addgene:80006; RRID:Addgene_80006). Supernatants containing lentiviral pseudoparticles were harvested 24 and 48 h post-transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-EF1a-DIO-eNpHR3.0-EYFP-WPRE-pA (4.0 × 1012 vg/mL, 1:2 dilution, UNC vector core using Addgene plasmid #26972 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral cloning vector pLKO.1-TRC and pcDNA3.1-C-Flag plasmids were purchased from Addgene (Watertown, MA, USA). The double-stranded oligonucleotide shRNAs targeting LINC00094 were cloned into the Age I/EcoR I sites of the pLKO.1-TRC lentiviral vector ...
-
bioRxiv - Plant Biology 2024Quote: ... the SacB expression cassette was first cloned into the p641-BpiI level 1 vector using pT18mobsacB (Addgene #72648) as PCR template ...
-
bioRxiv - Synthetic Biology 2024Quote: The pGDP1 NDM-1 and pGDP2 MCR-143 were gifts from Gerard Wright (Addgene plasmids #112883 and #118404). They were used as constitutive expression vectors for a codon-optimized blaNDM-1 (by the Pbla promoter ...
-
bioRxiv - Molecular Biology 2024Quote: ... p6346 MSCV-CMV-Flag-HA-Brd4-1-444 were from Peter Howley (Addgene 31352, 32886, 31353, 31354, 31355). Constructs for pcDNA5-Flag-BRD4 WT ...
-
bioRxiv - Neuroscience 2024Quote: ... the left eye was injected with 800 nL – 1 μL of AAV2/7m8-CAG-DIO-ChRger2-YFP (Addgene Plasmid #127329 packaged by BCH viral core) ...
-
bioRxiv - Cell Biology 2024Quote: ... full-length ARHGAP12 cDNA and ARHGAP12 fragments were PCR amplified and inserted into pEGFP-C1 (Addgene #6084-1) using appropriate restriction sites ...
-
bioRxiv - Bioengineering 2024Quote: ... was amplified using primers 5 and 6 listed in Supplementary Table 1 from pEPkan-S (Addgene plasmid #41017; http://n2t.net/addgene:41017; RRID:Addgene_41017) 13 and inserted into the XhoI site of pBS-Puro2ABFP-WPRE using GeneArt Gibson Assembly EX Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pLenti CMV Puro DEST (w118-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmid #17398, http://n2t.net/addgene:17398, RRID:Addgene_17398 ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmid encoding HIV-1 Gag-mCherry was a gift from Gregory Melikyan (Addgene plasmid # 85390 ; http://n2t.net/addgene:85390 ; RRID:Addgene_85390) (74) ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml) was a gift from Lin Tian (Addgene viral prep #111068-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Neuroscience 2020Quote: ... DIV 4 neurons were transfected with pGP-CMV-GCaMP6f (a gift from Douglas Kim, Addgene plasmid # 40755 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgFIGNL1#4: CCTATACCCAAGCAAGATGG) were cloned into lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid #52961) in a single-step digestion-ligation reaction (2 hours (h ...
-
bioRxiv - Neuroscience 2022Quote: [4] DsRed from pBac-DsRed-ORCO_9kbProm-QF2 (a gift from Christopher Potter, Addgene ID #104877) (Riabinina et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 x 105 cells from the previous transfection were transfected with pCMV-PEmax (Addgene: 174820)11 (800 ng ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Supplemental Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Sup. Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914)77 via Gibson Assembly.
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ; http://n2t.net/addgene:21474 ; RRID:Addgene_21474 49)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Gibson-assembled with the HaloTag gene amplified with primers HaloTag_F and HaloTag_R (Table 1) and pFA6a-HaloTag-KanMX6 (Addgene #87029) as a template ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: P-Lenti CMV/TO SV40 small + Large T (w612-1) was a gift from Eric Campeau (Addgene plasmid # 22298). For packaging the virus ...
-
bioRxiv - Genomics 2020Quote: ... shINTS2 and shINTS5 were designed with the Broad Institute algorithm (https://portals.broadinstitute.org/gpp/public/) and subsequently cloned into pLKO.1 (Addgene #10879). Sequences of all shRNAs are listed in the Key Resources Table ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Biochemistry 2021Quote: Gene encoding GFP was cloned under 1 kb promoter of GDH2 and PEPCK into pIB3 vector (Addgene plasmid #25452) and expressed in P ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Cell Biology 2021Quote: ... used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434; http://n2t.net/addgene:26434; RRID: Addgene_26434 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID: Addgene_8454 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid# 17452; RRID: Addgene_17452). The open reading frame for MCL1 was obtained as a gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV Puro DEST (w118-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid# 17452; RRID: Addgene_17452). The open reading frame for MCL1 was obtained as a gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569; RRIDs: Addgene_26429 and Addgene_27569). BCL2L1 (Bcl-xL ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Cell Biology 2021Quote: ... EGFP and 1 kb homology arms flanking the insertion site were cloned into pHD-DsRed-attP (Addgene plasmid #51019) using Infusion technology (Takara/Clontech) ...
-
bioRxiv - Cell Biology 2021Quote: ... pAAV-mDlx-GFP-Fishell-1 was kindly provided by Gordon Fishell (Addgene plasmid #83900; http://n2t.net/addgene:83900; RRID: Addgene_83900). The AAV plasmid vector including the mouse alpha-CaMKII promoter was kindly provided by Akihiro Yamanaka (Nagoya University) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Caprin-1 were expressed using a pET-derived expression vector (Addgene, pET His6 MBP Asn10 TEV LIC, 1C) in E.coli Rosetta as N-terminal fusions to an N-terminally His6-tagged E.coli maltose-binding protein (MBP) ...
-
bioRxiv - Biochemistry 2021Quote: ... targets were identified for testing in exon 1 Ensembl.org exon id=ENSMUSE00000375205 with the algorithm described by Hsu and colleagues52 and cloned into plasmid pX330 (Addgene.org plasmid #42230 ...
-
bioRxiv - Immunology 2020Quote: ... The sgRNA sequence against HPT (Table 1) was cloned into the pSS013-Cas9 vector (pU6 plasmid, Addgene plasmid # 52694) using the BsaI specific sites ...
-
bioRxiv - Neuroscience 2020Quote: ... we infected adult Brn3cCre mouse retinas with 1 ml Cre dependent AAV Virus (AAV2-CAG-FLEX-EGFP-WPRE, Addgene catalog # ...
-
bioRxiv - Cancer Biology 2021Quote: ... These pLKO.1 constructions were transfected in the 293T packaging cell line along with pMD2.G and pCMV-dR8.91 vectors (Addgene), following a typical Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and a separate master mix was prepared comprising 1 mL Opti-MEM 8 µg PSPAX (12260, Addgene, Watertown, MA), 2 µg PMD2G plasmids (12259 ...
-
bioRxiv - Biochemistry 2020Quote: ... To generate mec-4p∷hrp-1 mScarlet plasmids, mScarlet (Bindels et al., 2017) was amplified from pmScarlet_C1 (Addgene 85042) and assembled into hrp-1HsLCWT using NEBuilder HiFi DNA Assembly kit and introducing the D290V mutation by Quickchange ...
-
bioRxiv - Cell Biology 2022Quote: ... then ligated into the pENTR1A no ccDB (w48-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 17398 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and SV40-T/t antigens expressing lentiviruses using vectors pLenti CMV-RasV12-Neo (w108-1) (HRAS G12V, #22259, Addgene), and pLenti-CMV/TO-SV40 small + Large T (w612-1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Precission protease was produced as a GST fusion in Escherichia coli BL21 (DE3) from pGEX-6P-1 vector (Addgene). The cleaved Fc-fusion protein were passed through a protein-A column ...