Labshake search
Citations for Addgene :
1051 - 1100 of 1708 citations for KGF 2 FGF 10 Human 171a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... AAV1_hSyn1-SIO-stGtACR2-FusionRed (Addgene 105677, 2.1e+12 after 10 fold dilution) was used for optogenetic inactivation ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-10:LMNB1-mEGFP (Addgene plasmid #87422; http://n2t.net/addgene:87422; RRID:Addgene_87422), AICSDP-52 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-Syn-Flex-GCaMP6m-WPRE-SV40 (1×10¹³ vg/ml, Addgene 100838).
-
bioRxiv - Molecular Biology 2020Quote: The pooled Human GeCKO v2 CRISPR knockout plasmid library was a gift from Feng Zhang (41) and obtained from Addgene (#1000000048 and #1000000049). It is supplied as two sub-libraries ...
-
bioRxiv - Biochemistry 2021Quote: ... Pichia pastoris expression vector pPICZc carrying human β-actin fused with thymosin β4 and 6xHis-tag was a gift from Mohan Balasubramanian (Addgene #111146, RRID:Addgene_111146). β-Actin cDNA was mutated to introduce K50C and C374A for labeling with a cross-linking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: HT29 dCas9-VP64 clone E cells were transduced with lentivirus of Calabrese pooled human CRISPRa library set A and B (Addgene, 92379 and 92380) separately ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of human tau isoform 0N4R was subcloned into the pJFRC7 vector (Addgene, plasmid #26220. http://n2t.net/addgene:26220; RRID:Addgene_26220, a gift from Gerald Rubin43) to allow expression under the control of the GAL4/UAS system ...
-
bioRxiv - Cancer Biology 2024Quote: ... The construction of the two shRNA lentivirus vectors targeting the human β-catenin was performed following the Tet-pLKO Manual given by Addgene (plasmid#21915). The shRNA sequences used were the same as previously described (16) ...
-
bioRxiv - Cell Biology 2020Quote: ... the pET30-2-GAPDH plasmids was a gift from David Sabatini (Addgene plasmid # 83910) (Pacold et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327; http://n2t.net/addgene:19327; RRID:Addgene_19327), pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2) EF1α promoter and puro resistance gene were amplified from lentiGuide-Puro (Addgene #52963). 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA of SKAP2WT and SKAP2W336K (see Table 2) was transferred into pLEX_307 (Addgene #41392). For analysis of subcellular localization ...
-
bioRxiv - Microbiology 2021Quote: ... The pCRISPomyces-2 vector used in this study was obtained from Addgene (Code: 617374). All the media and chemicals were used in this study were purchased from Hi-media (Mumbai-India ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2×106 cells were co-transfected with Cas9 (pU6_CBh-Cas9-T2A-BFP: Addgene #64323) and gRNA (pSPgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... psiCHECK-2-Sal4-wt_3’UTR was a gift from Robert Blelloch (Addgene plasmid # 31862). psiCHECK-2-Rab GTPases were generated by inserting Rab GTPases into psiCHECK- 2-Sal4-wt_3’UTR by XhoI/NotI.Tetanus toxin light chain (Eisel et al. ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898 ...
-
bioRxiv - Neuroscience 2022Quote: ... All AAV plasmids presented in this study are available from Addgene (Supplementary Table 2).
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 gRNA plasmids were generated per construct and were integrated into pX330 (Addgene# 42230) using BbsI site as previously described 16 ...
-
bioRxiv - Molecular Biology 2019Quote: ... HA-SUMO-2 WT plasmid was a gift from Guy Salvesen (Addgene plasmid # 48967). Flag-PIAS4 WT plasmid was a gift from Ke Shuai (Addgene plasmid # 15208) ...
-
bioRxiv - Neuroscience 2019Quote: ... astrocytes were transfected with 2 μg of pLYS1-FLAG-MitoGFP-HA (Addgene plasmid # 50057) which contains the pore-forming subunit of the mitochondrial calcium uniporter coupled to GFP or a mito-mCherry construct generated by subcloning the targeting sequence of the pLYS1-FLAG-MitoGFP-HA plasmid into the mcherry2-N1 vector (Addgene plasmid # 54517) ...
-
bioRxiv - Immunology 2021Quote: The mammalian expression plasmid containing SARS-CoV-2 HexaPro spike was obtained from Addgene (Addgene plasmid # 154754 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2) the NLS-Cas9 gene from the pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) connected to the promoters and 3’-UTRs from the β2tubulin (AAEL019894) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa cells (ATCCCCL-2) were transiently transfected with SpCas9-expressing PX459 plasmid (Addgene # 62988) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid #154754) 21 ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3.1-GFP(1-10) was a gift from Bo Huang (Addgene plasmid # 70219). 2PH-PLCdelta-GFP was a gift from Sergio Grinstein (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cells were co-electroporated with 10 μg pCBA-SceI (Addgene, plasmid #26477) (44 ...
-
bioRxiv - Cell Biology 2019Quote: ... mVenus-VE-Cadherin-N-10 (Addgene plasmid # 56340; http://n2t.net/addgene:56340; RRID:Addgene_56340) was a gift from Michael Davidson and was used as acquired ...
-
bioRxiv - Immunology 2021Quote: ... mApple-CD36-C-10 was a gift from Michael Davidson (Addgene plasmid # 54874). The pET23a vector ...
-
bioRxiv - Biophysics 2021Quote: ... was a gift from Michael Davidson (mApple-MAPTau-N-10, Addgene plasmid # 54925). Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.1×10^13 g.c./mL AAV9-hSyn-DIO-hM4D(Gi)-mCherry from Addgene, 2.1×10^13 g.c./mL AAV9-hSyn-DIO-hM3D(Gq)-mCherry from Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV1-hSyn-Cre-WPRE-hGH (Addgene, 10^13 gc/ml, diluted 1:5), AAV5-CAG-FLEX-tdtomato (UNC Viral Core ...
-
bioRxiv - Cell Biology 2020Quote: mRuby2-MannII-N-10 was a gift from Michael Davidson (Addgene plasmid # 55903)(83) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV8-hSyn-DIO-hM3Dq-mCherry virus (Addgene, Plasmid #50475, titer 1.9×10^13). was injected into LH Leptin receptor-expressing (LepR ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected AAV5-CAG-FLEX-ArchT-tdTomato (titer 10^13 gc/mL, Addgene) in the DLS ...
-
bioRxiv - Microbiology 2020Quote: ... pQCXIP-BSR-GFP11 and pQCXIP-GFP1-10 were from Yutaka Hata 51 (Addgene plasmid #68716 ...
-
bioRxiv - Plant Biology 2019Quote: ... Clover coding sequence was amplified from Clover-mRuby2-FRET-10 (M. Davidson, Addgene) with oGD317 and oGD318 and cloned in pGGD000 with a linker made up by annealing oGD315 and oGD316 (D-TGCA linker ...