Labshake search
Citations for Addgene :
901 - 950 of 1829 citations for KGF 2 FGF 10 Human 171a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: [2] QF2-Hsp70 from pattB-synaptobrevin-7-QFBDAD-hsp70 (Addgene plasmid #46115) (Primers ...
-
bioRxiv - Neuroscience 2020Quote: The pCMV4-FLAG-UBQLN2 plasmid (p4455 FLAG-hPLIC-2; Addgene plasmid # 8661) and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2 ng/μl RNase-free plasmid DNA (pX330, Addgene #42230) in a 15 ml Falcon tube ...
-
bioRxiv - Molecular Biology 2020Quote: 2 μl RNase-free plasmid DNA (pX330, Addgene #42230, 100 ng/μl),
-
bioRxiv - Bioengineering 2021Quote: We cloned the TRS-Leader-SARS-CoV-2-d2eGFP plasmid (Addgene 171585) by introducing 75 nt of the SARS-CoV-2 Leader sequence into the NheI-digested EFS-EGFPd2PEST-2A-Hygro plasmid (Addgene 138152) ...
-
bioRxiv - Biochemistry 2021Quote: The plasmid SARS-CoV-2 3xFlag-His-nsp5CS-nsp15 (Addgene ID: 169166) was used to express 3xFlag-His-nsp5CS-nsp15 in baculovirus-infected insect cells (Supplementary Table S1 and S2) ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV4-FLAG-UBQLN2 plasmid (p4455 FLAG-hPLIC-2; Addgene plasmid # 8661) and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1 ...
-
bioRxiv - Systems Biology 2021Quote: ... Ago2_KO1 mESCs were transfected with pX458-sgRNA_Ago1_1/2 (Addgene #73533 and #73534), and pX458-sgRNA_Ago1_3/4 (Addgene #73535 and #73536 ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Genetics 2021Quote: ... pLVX-EF1alpha-SARS-CoV-2-orf8-2xStrep-IRES-Puro (Addgene plasmid #141390). Orf8 deletion constructs were produced on the Orf8 backbone using Pfu Turbo HotStart DNA polymerase (Agilent 600322-51 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... β-arrestin 2 was amplifying from pCDNA3.1(+)-CMV-bArrestin2-TEV (Addgene #107245) with Gibson Assembly primers compatible with the NEBuilder HiFi DNA Assembly Kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... (2) sfGFP was amplified from template pHD-sfGFP Scareless dsRed (Addgene 80811) and (3 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ...
-
bioRxiv - Neuroscience 2021Quote: ... hSS were labeled with AAV-DJ-mDlx-GCaMP6f-Fishell-2 (Addgene, 83899) and placed in a well of a Corning 96-well microplate (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... (C1)2-GFP was a gift from Tobias Meyer (Addgene plasmid #21212) and RBD-GFP from Burridge lab ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) was injected 400 μm below the dura (4-10 sites ...
-
bioRxiv - Genetics 2020Quote: ... HUDEP-2 cells with stable expression of LentiCas9-Blast (Addgene plasmid 52962) were transduced at a low multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988, Addgene) using Lipofectamine 3000 (L3000001 ...
-
bioRxiv - Molecular Biology 2021Quote: pLVX-EF1alpha-SARS-CoV-2-Nsp1-2XStrep-IRES-Puro plasmid (Addgene, 141367) and pLVX-EF1alpha-SARS-CoV-2-Nsp2-2XStrep-IRES-Puro plasmid (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: Burrhole injections of viral constructs [rAAV2/1&2.hSyn.SIO-eOPN3-mScarlet (Addgene 125713 diluted to 6 × 1012 viral genomes/mL ...
-
bioRxiv - Neuroscience 2024Quote: Adeno-associated virus (AAV) type 2 carrying cre-dependent ChR2-eYFP (Addgene plasmid 20298 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSynapsin1-hM3D(Gq)-mCherry (Addgene, #50474, ≥ 2 x 1012 vg/ml) or AAV9-hSynapsin1-Lamp1-mScarlet-I (3.06 x1012 vg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Neuroscience 2023Quote: ... pBS-KS-attB2-SA(2)-T2A-LexA::QFAD-Hsp70 (Addgene plasmid #62949) and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957 ...
-
bioRxiv - Microbiology 2023Quote: A plasmid encoding the SARS-CoV-2 Spike was obtained from Addgene #145032 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-mDlx-GCaMP6f-Fishell-2 was a gift from Gordon Fishell (Addgene plasmid # 83899-AAV1 ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 53BP1-mCherry was excised mCherry-BP1-2 pLPC-Puro (Addgene plasmid #19835) (Dimitrova et al ...
-
bioRxiv - Synthetic Biology 2023Quote: The promoters from the genes alcohol dehydrogenase 2 (ADH2, Addgene ID 195015), xylose reductase (XYL1 ...
-
bioRxiv - Cell Biology 2023Quote: ... pRC/CMV::DVL-2-Myc was obtained from Addgene (Cambridge, Massachusetts, USA) (plasmid #42194 ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700; http://n2t.net/addgene: 180700; RRID:Addgene_180700) were gifts from David Nemazee (46 ...
-
bioRxiv - Cancer Biology 2023Quote: ... + pLenti-CMV-GFP-Neo (657-2) GFP expression vector (Addgene, Plasmid 17447). All cells were cultured with RPMI 1640 media ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 2 µg of the envelope plasmid (pMD2.G / VSVG, Addgene #12259) per well were co-transfected using PEI ...
-
bioRxiv - Developmental Biology 2024Quote: ... 293T cells were transfected with 2 μg of pMD2.G (Addgene, 12259), 4 μg of psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... pDONR207 SARS-CoV-2 nsp1 Delta RC (M1, K164A/H165A, Addgene #164522) and pDONR207 SARS-CoV-2 nsp1 R124A/K125A (M2 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid YFP-SRI was generated by sub-cloning human sorcin cDNA taken from pAd-hSRI (22) into KpnI-ApaI sites of mVenusC1 (Addgene #27794).
-
bioRxiv - Molecular Biology 2020Quote: FLAG-mEm-WT Tau and FLAG-mEm-Tau K174Q sequences were cloned into pAAV2 vector under human synapsin promoter (Addgene, #50465). Adenoviral particles were used to infect a primary hippocampal culture.
-
bioRxiv - Molecular Biology 2021Quote: ... similar to how we previously generated the human cell expression constructs for AcrIIA4 and AcrIIA5 (Addgene IDs 133801 and 133802, respectively) (see Supplementary Sequences) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Δ50 were PCR amplified from human templates using forward (fwd) primer 1593 and reverse (rev) primer 1651 and inserted into mycBioID2 pBabe puro (Addgene #80901) cut EcoRI to PmeI ...
-
bioRxiv - Genetics 2019Quote: sgRNAs targeting human ADCK4 (sgRNA1: GCTGCACAATCCGCTCGGCAT, sgRNA2: GTAAGGTCTGCACAATCCGCT, and sgRNA3: GACCTTATGTACAGTTCGAG,) were cloned into BsmBI-digested lentiCRISPR v2 (Addgene plasmid #52961). ADCK4 cDNA was cloned into the p3xFLAG CMV26 (C-terminal ...
-
bioRxiv - Neuroscience 2020Quote: ... was cloned into a rAAV vector under the human synapsin promoter using the plasmid pAAV-hSyn-EGFP (gift from Bryan Roth; Addgene, #50465) as backbone and removing EGFP ...
-
bioRxiv - Neuroscience 2020Quote: UAS-SMARCA1 construct: Flies carrying UAS-SMARCA1WT were generated using human SMARCA1 cloned into the pFastBac Dual vector (Addgene plasmid #102243). Gateway cloning (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Cell Biology 2021Quote: ... The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene; plasmid #30116). All constructs were confirmed by sequencing.