Labshake search
Citations for Addgene :
1051 - 1100 of 1985 citations for Cis Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%; 1 D 97% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... we additionally injected an AAV encoding for jRGECO1a (AAV2/1-Syn-NES-jRGECO1a-WPRE-SV40, Addgene 100854-AAV1) in 3 locations in V1 (roughly the vertices of a 550 μm-wide equilateral triangle centered 3.5 mm posterior and 2.6 mm lateral to Bregma ...
-
bioRxiv - Cell Biology 2023Quote: ... were created via PCR amplification (see primer list) and assembled into a Spe-1 digested pCFJ151 (Addgene #19330) vector using isothermal assembly (Gibson et al. ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... flanked by 1-kb Nelfe HDR sequences: The insert was obtained from pCRIS-PITCHv2-dTAG-Puro (Addgene 91796) (Nabet et al ...
-
bioRxiv - Genomics 2022Quote: ... The open reading frames of H3 and H4 were cloned in the Dox-inducible expression vector KA0717 (KA0717_pPB-hCMV*1-cHA-IRESVenus was a gift from Hans Schöler, Addgene plasmid #124168 ...
-
bioRxiv - Developmental Biology 2023Quote: ... nls::Cas9::nls (subcloned from Eef1a-1955/- 1>nls::Cas9::nls a gift from Lionel Christiaen, Addgene plasmid # 59987 ;http://n2t.net/addgene:59987 ; RRID:Addgene_59987)52 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... coding for the large T oncogene SV40 (V40 1: pBSSVD2005 was a gift from David Ron; Addgene plasmid #21826; http://n2t.net/addgene:21826; RRID:Addgene_21826), using LipofectamineTM LTX (Invitrogen #L3000-008 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (MSCV-IRES-Thy1.1 DEST was provided to Addgene by Dr. Anjana Rao, Addgene plasmid# 17442 ; http://n2t.net/addgene:17442 ; RRID:Addgene_17442) using TaKaRa In-Fusion HD Cloning Plus kits (Cat# 638917 ...
-
bioRxiv - Neuroscience 2023Quote: ... The annealed oligos were then ligated into U6 promotor-based cassettes: ipo13b sgRNA1 into pU6a:sgRNA#1 (Addgene #64245), ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-HA-Ubiquitin (Ub) was a gift from Edward Yeh (Addgene plasmid #18712; http://n2t.net/addgene:18712; RRID:Addgene_18712). Full length tsa56 (OTT_0945 ...
-
bioRxiv - Cell Biology 2023Quote: ... pAS139 was used in a multi-site Gateway LR reaction together with entry plasmids pCG142 (pie-1 intron:pie-1 promoter in PDONRP4P1R) and pCM1.53 (GFP with worm codon bias and synthetic introns in pDONR201) (Addgene plasmids # 17246 and # 17250 ...
-
bioRxiv - Cancer Biology 2023Quote: We cloned the following oligonucleotides into the pLKO.1 mCherry constitutive vector (Dr Oskar Laur’s lab, Cat#128073; RRID:Addgene_128073) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 µL of a mix of pAAV-TREtight0mTag-BFP2- B19G (diluted 1:20 in dPBS; Addgene: 100799-AAV1) and pAAV-syn-FLEX-splitTVA-EGFP- tTA (diluted 1:200 in dPBS ...
-
bioRxiv - Physiology 2023Quote: ... 1 ng of pcDNA3.3-hCas9 plasmid (constructed by inserting the Cas9 fragment released from Addgene #41815 (ref. 130), into the pcDNA3.3 vector ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900; http://n2t.net/addgene:83900; RRID:Addgene_83900) by restriction subcloning ...
-
bioRxiv - Cancer Biology 2024Quote: ... (shp53 pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 19119 ; http://n2t.net/addgene:19119 ; RRID:Addgene_19119)) [46].
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Cancer Biology 2024Quote: ... WT and mutant constructs were subsequently cloned into the vector pLenti CMV Neo DEST (705-1) (Addgene, #17392) by the GATEWAY cloning system ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/1 (a gift from James M. Wilson, Addgene plasmid #112862; http://n2t.net/addgene:112862; RRID: Addgene_112862) were used for virus production ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Microbiology 2024Quote: ... were cloned into CMV Blast DEST (706–1) (a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451) expression vector resulting in plasmid AX581 ...
-
bioRxiv - Cancer Biology 2024Quote: ... subcloning and sequencing The pLJM1-empty (#91980) and PD-1-miSFIT-1x (#124679) vectors were purchased from Addgene. PTEN and PD-1 were subcloned into linearized pLJM1-empty vector using EcoR1 and NHE1 restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2024Quote: The pLKO.1 – TRC cloning vector was a gift from David Root (Addgene plasmid # 10878; http://n2t.net/addgene:10878 ; RRID:Addgene_10878). The shRNA sequences were cloned into the AgeI and EcoRI sites of the plasmid using standard cloning techniques ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression vectors for NFAT4 D-site variants were prepared by subcloning residues 3 – 407 of WT NFAT4 from the corresponding mammalian expression vector (Addgene #21664) into pGEX4T1 ...
-
bioRxiv - Cell Biology 2022Quote: ... was a gift from Sean Munro (MRC Laboratory of Molecular Biology). The CENPB-mCh plasmid (D. Liu et al., 2010) was generated by Michael Lampson and obtained from Addgene (#45219).
-
bioRxiv - Molecular Biology 2022Quote: ... pXR003 processed gRNA was cloned into pKLV2.3-Hygro mCherry gRNA lentiviral plasmid (33) using EcoRI and Mlu and amplying (d)CasRx directed repeats from pXR003 processed gRNA (Addgene #109053) using the following F (CCCACGCGTGAGGGCCTATTTCCCATGATTC ...
-
bioRxiv - Microbiology 2023Quote: ... The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The primer sequences used in amplifying human and mouse CUL1 and UBE2L3 coding sequences are listed in Table 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Titer: 1.8×1013 GC/mL (Addgene – diluted ½) or 4.5×1012 GC/mL (VVF) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 100 ng of transposase-expressing helper plasmid (Mates et al. [74] Addgene #34879) was co-transfected with 1000 ng of InterTag or InterCatch ...
-
bioRxiv - Neuroscience 2022Quote: We injected a single 100 nL of AAV2-retro-GFP (Addgene #37825-AAVrg) in the left agranular RSC (AP ...
-
bioRxiv - Neuroscience 2022Quote: ... wildtype mice were injected with 100-200 nl AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, Addgene) in the posterior cerebellum (AP -7.2 ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP, 108vg/ml, Addgene #28304-PHPeB) at DIV 9-10 and processed for experiments 10-11 days later.
-
bioRxiv - Neuroscience 2021Quote: ... viral titer of 5.86×1013 particules/ml) and the Cre recombinase (AAV9-hSyn-Cre, from Addgene, 3.3×1013p/ml), diluted at a factor 10 and 100 respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV9 CaMKII-eGFP (3.45×10^12 virus molecules/mL)(Penn) or AAV5-hDlx-ChR2-mCherry (7.6 ×10^14 virus molecules/mL) (Addgene plasmid # 83898 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5.2×1012 gc/ml) and AAV2/5-hSyn-DIO-hM3Dq-mCherry (7.8×1012 gc/ml) were produced from Addgene plasmids #44362 and #44361 at the facility of Nantes University (UMR 1089 ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP, 108vg/ml, Addgene #28304-PHPeB) at DIV 9-10 and processed for experiments 10-11 days later.
-
bioRxiv - Neuroscience 2024Quote: ... 1.03 × 1013 vg/mL), and AAV-mCherry (pAAV9-hSyn-mCherry; 114472-AAV9, 9.0 × 1012 vg/mL) viruses were purchased from Addgene. AAV-Rem2-wt (AAV9-hSyn1-Myc-Rem2-WPRE ...
-
bioRxiv - Biochemistry 2021Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, 12259) and pTAT (kind gift of P ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, #12259) and pTAT (kind gift of P ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ; http://n2t.net/addgene:21474 ; RRID:Addgene_21474 49)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Gibson-assembled with the HaloTag gene amplified with primers HaloTag_F and HaloTag_R (Table 1) and pFA6a-HaloTag-KanMX6 (Addgene #87029) as a template ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: P-Lenti CMV/TO SV40 small + Large T (w612-1) was a gift from Eric Campeau (Addgene plasmid # 22298). For packaging the virus ...
-
bioRxiv - Genomics 2020Quote: ... shINTS2 and shINTS5 were designed with the Broad Institute algorithm (https://portals.broadinstitute.org/gpp/public/) and subsequently cloned into pLKO.1 (Addgene #10879). Sequences of all shRNAs are listed in the Key Resources Table ...
-
bioRxiv - Cancer Biology 2019Quote: ... MiR-146a over-expression cassette was sub-cloned from pU61 into the pLKO.1 TRC vector (Addgene plasmid #10878). Packaging plasmids psPAX2 (Addgene plasmid # 12260 ...