Labshake search
Citations for Addgene :
1051 - 1100 of 2708 citations for 7 Chloro 2 hydrazino 5 phenyl 3H 1 4 benzodiazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2022Quote: ... Circuit-specific viral expression was achieved using the retrograde properties of adeno-associated virus (AAV) serotype 5 23: AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540). Sparse labelling was obtained using Cre-inducible ...
-
bioRxiv - Cell Biology 2020Quote: ... Animals received a single dose of AAV8.TBG.null or AAV8.TBG.p21 (5*10^12 units/ml) (Addgene) intravenously allowed 1 week wash-out period on normal diet ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860; http://n2t.net/addgene:55860; RRID:Addgene_55860). Matrix-roGFP (mt-roGFP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the first 639 bp of the 5’ end of p65HSF1 from pAC1393-pmax-NLSPUFa_p65HSF1 (Addgene, #71897). These were then Gibson assembled along with an IDT gBlock containing the last 300 bp of p65HSF1 that had been codon optimised for expression level detection distinct from endogenous mRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... 400 nl of AAV2/5-CAG-dLight1.1 (1.7×1013 GC/ml, 111067-AAV5, Addgene, Watertown, MA, USA) was slowly injected into the DMS (n = 7 ...
-
bioRxiv - Genetics 2023Quote: ... the FKBP coding sequence was amplified from the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... and the sgRNA cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmids were named pGGG-ZIP4-B2 Construct 1 (containing sgRNA 4 and 12 ...
-
bioRxiv - Systems Biology 2024Quote: We established a stable Cas9-expressing line by infecting EpiSC-5 cells with lentiCas9- Blast (Addgene 52962), followed by selection with 5 µg/ml blasticidin (Sigma 15205 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5.CaMKII.tdTomato (Neurophotonics, 661-aav5) was used to label excitatory neurons and AAV9.CaMKII.GCaMP6s.WPRE.SV40 (Addgene, 107790) was employed to image excitatory neuronal calcium activity ...
-
bioRxiv - Neuroscience 2023Quote: ... RRID:Addgene_20297) or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Neuroscience 2019Quote: ... and a 1:1 solution of AAV1.Syn.GCaMP6f.WPRE.SV40 (Addgene) and AAV1.mDlx.GFP-GCaMP6f-Fishell-2.WPRE.SV40 (Penn Vector Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pRSFDuet-1 IntS8 AA 1-308 (Addgene #196905), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1 mixture of pENN.AAV.CamKII 0.4.Cre.SV40(AAV1; Addgene #105558 ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Bioengineering 2020Quote: ... pCXLE-hMLN and pCXLE-hOCT3/4 that were a gift from Shinya Yamanaka (Addgene plasmid # 27078, 27079 and 27076), according to previously reported papers(80,81) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259) were transfected into HEK-293 T cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259)) were transfected into HEK-293 T cells (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2023Quote: ... hGM-CSF and hIL-4 were produced from HEK293 cells stably transduced with pAIP-hGMCSF-co (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446; http://n2t.net/addgene:17446; RRID: Addgene_17446). pLenti CMV GFP Hygro (656-4 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2.5 ng/mL Pmyo-2::mCherry as a co-injection marker (pCFJ90, Addgene #19327). Microinjection of adult N2 hermaph-rodites was performed as described above ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 μg of pSpCas9(BB)-2A-GFP (PX458) (gift from Feng Zhang, Addgene plasmid #48138) containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...
-
bioRxiv - Biophysics 2021Quote: The plasmid with cDNA encoding SARS-Cov-2 spike HexaPro (S) was obtained from Addgene. To express the S protein ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G, Addgene #12259) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 2 mL transfection mixture containing lentiviral packaging plasmids 7.5 µg pMD2.G (#12259, Addgene), 11.4 µg pMDLg-RRE (#12251 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HN30 and HN31 cell lines were transfected with 2 μg mCherry (Addgene, Plasmid 41583) as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... we used an existing CMV-driven SARS-CoV-2 plasmid (pcDNA3.1-SARS2-Spike, Addgene 145032)(Shang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Cell Biology 2019Quote: ... the guide RNA sequence (Supplemental Item 2) was cloned into the PX330 plasmid (Addgene #42230), which expresses S ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Microbiology 2021Quote: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... Retro-AAV2 coding for mCherry (pAAV2-hSyn-mCherry, Addgene #114472, 2 x 1013 GC/ml) and green fluorescent protein (pAAV2-hSyn-eGFP ...
-
bioRxiv - Microbiology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (a gift from Nevan Krogan, Addgene plasmid # 141382) was used to express S-protein from the original SARS-CoV-2 strain (WT) ...
-
bioRxiv - Molecular Biology 2023Quote: 2 µg total of multiplex sgRNA vector and EF1α-dCas9-VPR-Puro vector (Addgene #99373) at a 2:1 molar ratio were mixed with 5 µl of Lipofectamine 2000 (Thermo ...
-
bioRxiv - Genomics 2023Quote: ... guide pair 2: TTGCGGCGCTGTGGCGCCGA and CGCTCCCGCAAGTGGATGTC) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described [49] ...
-
bioRxiv - Biophysics 2022Quote: SARS-CoV-2 S HexaPro plasmid was a gift from Jason McLellan (Addgene plasmid # 154754). This plasmid contains CMF promotor driven expression of the SARS-COV-2 Spike-B.1 ectodomain (1-1208 AAs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were co-transfected with enveloping (pCMV14-3X-Flag-SARS-CoV-2 S (Addgene #145780) for PVs or pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...