Labshake search
Citations for Addgene :
1301 - 1350 of 2708 citations for 7 Chloro 2 hydrazino 5 phenyl 3H 1 4 benzodiazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... we co-electroporated animals at stage 46-47 with pGP-CMV-GCaMP6f (2 mg/mL, Addgene plasmid # 40755) and CMV-turboRFP (1mg/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068; http://n2t.net/addgene:19068 ; RRID:Addgene_19068). FLT3-WT and FLT3-ITD ORFs were cloned in pLEX_307 (gift from David Root (Addgene plasmid #41392 ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899; http://n2t.net/addgene:83899; RRID:Addgene_83899) (88 ...
-
bioRxiv - Microbiology 2021Quote: ... and pLenti CMV GFP Neo (657-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17447). Expression plasmids SARS2-S2’-AA ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780; http://n2t.net/addgene:145780; RRID:Addgene_145780) 38 ...
-
bioRxiv - Immunology 2020Quote: ... The vector pEQ276 (encoding CMV IE1 and 2 genes) was a gift from Adam Geballe (Addgene plasmid #83945)67 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Streptomyces pyogenes (sp) guide RNA sequences (Table 2) were cloned into the LentiGuide-Puro plasmid (plasmid #52963, Addgene). lentiGuide-Puro was a gift from Feng Zhang (Addgene plasmid # 52963 ...
-
bioRxiv - Cell Biology 2019Quote: ... we designed sgRNAs targeting exon 2 using CHOPCHOP (http://chopchop.cbu.uib.no/index.php) and cloned these sequences into lentiguide-puro (Addgene, cat. 52962). All lentiviruses were prepared by cotransfecting HEK293T cells with the lentivector ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ; http://n2t.net/addgene:57461; RRID:Addgene_57461). CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 μg of total plasmid DNA/well were used in appropriate combinations of the plasmids: pLVX-puro (Addgene), pLVX-puro-TRIM67-Flag ...
-
bioRxiv - Genomics 2020Quote: FUS-/- cells were generated by transient transfection of U-2 OS cells with pX459 (v2, Addgene plasmid #62988) vectors(Ran et al. ...
-
bioRxiv - Biophysics 2019Quote: ... SUM-159 cells genome edited to express σ2-EGFP [2] and transiently expressing mRuby-CLTB (Addgene; Plasmid #55852) were cultured in F-12 medium with hydrocortisone ...
-
bioRxiv - Immunology 2020Quote: ... pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422; http://n2t.net/addgene: 27422; RRID: Addgene_27422) (Oka et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... YAP–HaloTag CRISPR knock-in U-2 OS cells were transfected with pEGFP-C3-Lats1 (Addgene plasmid # 19053) or pEGFP C3-Mst2 (Addgene plasmid # 19056) ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898; http://n2t.net/addgene:153898; RRID:Addgene_153898). MLV-gag/pol ...
-
bioRxiv - Molecular Biology 2022Quote: All engineered SARS-CoV-2 S variant ectodomains were designed based on the HexaPro gene (Addgene plasmid #154754) containing stabilizing proline mutations at positions F817P ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-mDlx-GCaMP6f-Fishell-2 was a gift from Gordon Fishell (Addgene plasmid # 83899-AAV1; http://n2t.net/addgene:83899; RRID:Addgene_83899), was infected in 4 DIV neurons and imaged 12-13 DIV inhibitory interneurons ...
-
bioRxiv - Cancer Biology 2022Quote: ... pENTR4-FLAG (w210-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17423 ; http://n2t.net/addgene:17423 ; RRID:Addgene_17423), pGP (retroviral Pol and Rev gene plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-HEK 293T cells were generated using the CRISPR/Cas9 system from Addgene (http://www.addgene.org/). The sequences for guide RNAs were obtained from http://tools.genome-engineering.org and https://www.addgene.org/pooled-library/zhang-human-gecko-v2/ ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received 2 separate unilateral microinjections (males 0.2 µL, females 0.15 µL) of retrograde-transported AAV (AAVretro) constructs (Addgene) in the RVLM and CVLM (RVLM-males ...
-
bioRxiv - Cell Biology 2023Quote: Day 5 moDCs previously transfected with either NT or gal9 siRNA were transfected with 2 ug of the Str-KDEL_TNFα_SBP_EGFP plasmid (Addgene, #65278) (Boncompain et al ...
-
bioRxiv - Biochemistry 2023Quote: ... P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746; http://n2t.net/addgene: 23746; RRID:Addgene_23746) (Johannessen et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... The pWPXLd-OGT-GFP fusion vector was described in our previous articles,(2) pET24a-ncOGT-FL (190821, Addgene), other plasmids were cloned into pcDNA3.1 backbone with c-myc or HA tag.
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with either (G4C2)92 and (G4C2)2 lentiviral transfer plasmids along with PAX (Addgene #12260) and VSV-G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2024Quote: ... and T7 Ocr (NCBI Accession # NP_041954.1) genes were cloned into UC Berkeley Macrolab vectors 2-BT (Addgene #29666) and 13S-A (Addgene #48323 ...
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075; http://n2t.net/addgene:158075; RRID:Addgene_158075). The RBD amino acid sequence 328-537 encoded in this plasmid is identical to the sequence of RBD that we studied here ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075; http://n2t.net/addgene:158075; RRID:Addgene_158075). The RBD amino acid sequence 328-537 encoded in this plasmid is identical to the sequence of RBD that we studied here ...
-
bioRxiv - Cell Biology 2022Quote: Kinesin-1-GFP: Plasmid coding for kinesin-1-GFP was purchased from Addgene repository (#129761) ...
-
bioRxiv - Biophysics 2022Quote: ... Kinesin 1 1-401 (K401) was PCR amplified from pWC2 plasmid (Addgene # 15960). Ncd 236-701 was PCR amplified from a plasmid gifted by Andrea Serra-Marques.
-
bioRxiv - Cancer Biology 2019Quote: ... 293T cells were transfected with the sgRNA vector and a 1:1:1 mixture of lentiviral packaging constructs (Addgene #12251, #12253, #8454) using polyethylenimine transfection reagent ...
-
bioRxiv - Bioengineering 2023Quote: ... we followed the protocol of our previous study20 to transfected 6 individually isolated fibroblast lines with 4 μg of episomal plasmid (#58527; Addgene, Watertown, MA, USA) using the NucleofectorTM II with the A-024 program (Amaxa ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Cell Biology 2020Quote: ... using primer sequences 5’-TGTACCGGTCTCGAGGCCACCAT-GGTGGGTGAGG and 5’-AGATCCGGAGCTGTG-CCCCAGTTTGCTA, and cloned in place of EGFP in pT7-EGFP-C1-HsDCP1a (Tritschler et al., 2009) (Addgene # 25030). We then excised the FP635-DC-P1a cassette and blunt cloned into d2EGFPβ-glo-bin-UTR in place of the d2EGFP coding region.
-
bioRxiv - Genetics 2021Quote: mks-3::gfp transgenes were generated with PCR-based fusion of mks-3 gDNA (including 485 bp of 5’ UTR sequence) with GFP (pPD95_77, gift from Andrew Fire, Addgene plasmid #1495). All primers are listed in Table S4 ...
-
bioRxiv - Genetics 2020Quote: Flies expressing a gRNA targeting the rosy (ry) locus (5’-CATTGTGGCGGAGATCTCGA-3’) were generated by cloning the gRNA sequence into the pCFD3 plasmid (Addgene #49410) as in [44] ...
-
bioRxiv - Molecular Biology 2020Quote: ... All cell lines used to assess mitotic progression (Figures 5 and S7) were generated by co-transfecting pcDNA3 encoding mCherry-tagged Histone H2B (Addgene: 20972) and pcDNA3 encoding GFP-tagged Lamin B1 (a kind gift from David Vaux) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Oligonucleotides encoding sgRNA protospacer sequences (Extended Data Table 5) were annealed and cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang, Addgene plasmid # 42230) as described previously47 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’–CACCTTTGCCACTCTCAAAGGGGA-3’ and sgRNA REV: 5’-AAACTCCCCTTTGAGAGTGGCAAA-3’) was cloned into a BbsI digested pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (42230; Addgene, Cambridge MA). Template DNA for in vitro transcription was generated by PCR amplification of the gRNA sequence—which included both the guide sequence as well as the scaffold sequence encoded in the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid—using Phusion HF DNA polymerase and a primer set (synthesized by IDT ...
-
bioRxiv - Cell Biology 2019Quote: ... The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397) as a gift from David Liu [31] ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 sgRNAs targeting DIS3L2 (generated using the ChopChop tool (Labun et al., 2019)) were cloned into lentiGuide-Puro (Addgene #52963). The individual sgRNAs were subsequently transduced into MCF10a cells stably expressing pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911 ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence (5’-GCCCAATTCAGAGAGACATG-3’) targeting the genomic region immediately downstream the CDK12 start codon was cloned into the PX458 vector (Addgene 48138). The 3xFLAG knock-in repair template was constructed in a pTOPO-TA vector (Mei5bio ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Neuroscience 2020Quote: ... targeting exon 3 of the Prnp gene (5′-TCA GTC ATC ATG GCG AAC CT −3′) was cloned into the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene 50946,) to generate pKLV-Prnp sgRNA plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... Oligo nucleotides containing CRISPR target sequences (5’-CCGGCCGGGCCTACGGCTTG-3’) were annealed and ligated into pSpCas9 (BB)-2A-GFP (PX458) (Addgene 48138). Then ...
-
bioRxiv - Microbiology 2021Quote: An sgRNA (5’-ATCACAACGATCTGTTCGTC-3’) targeting the LGMN gene was cloned into the PX459 plasmid (Addgene plasmid #62988 from Feng Zheng51) encoding Cas9 and puromycin resistance ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Immunology 2022Quote: The CRISPR target site for murine p53 (single guide (sg) RNA: 5’-CTGAGCCAGGAGACATTTTC-3’) was already cloned into a px330 plasmid (px330-U6-Chimeric_BB-CBh-hSpCas9, Addgene plasmid #42230) and for human p53 (sgRNA ...