Labshake search
Citations for Addgene :
1051 - 1100 of 2656 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg AAVS1-TALEN L plasmid (Addgene #59025), and 5mg donor plasmid (AAVS1 TREG EBdCas9 or AAVS1 TREG EBNCdCas9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of packaging plasmids psPAX2 (Addgene, #12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... pMDLg/pRRE (Addgene 658-5, 12259, 12251, 12253) to generate lentiviruses expressing ANDV or TULV N proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg packaging plasmid pUMVC (Addgene, Plasmid #8449), 6.5 μg envelope plasmid pCMV-VSV-G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of pVSV-G (Addgene, plasmid # 8454), and 10 μg of the desired plasmid ...
-
bioRxiv - Bioengineering 2023Quote: ... together with tFucci(CA)5 plasmid29 (Addgene #153521), as per manufacture’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5-hSyn-DIO-EGFP (Addgene # 50457-AAV5) or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9) ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μg/flask of psPAX2 (Addgene 12260) using EndoFectin Lenti transfection reagent (GeneCopoeia ...
-
bioRxiv - Immunology 2024Quote: ... with 5 µg of HA-HIF1alpha (Addgene#18949) and HA-HIF1alpha P402A/P564A-pcDNA3 (Addgene#18955) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid, #86551). Cells were electroporated using the Neon Transfection System (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µg of pMD2.G (#12259, Addgene) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...
-
bioRxiv - Biochemistry 2021Quote: ... guide sequences 5’GGCATTGCCCGTCATGGCCC3’ and 5’GTCTTCACCGAGCTCATTAA3’ were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang; Addgene plasmid # 42230) and co-transfected with a GFP-expressing plasmid into HCT116 cells using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Developmental Biology 2024Quote: ... as well as non-targeting control gRNAs80 were synthesized with overhangs (sense: 5′-ACCG, antisense: 5′-AAAC) subcloned into the BsaI sites of pGL3-U6-sgRNA-EGFP (Addgene # 107721)81.
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1-shCltc1/ shCltc2/ shCltc3 were individually cotransfected with psPAX2 (ADDGENE NO. 12260), pMD2.G (ADDGENE NO ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3.1-GFP(1-10) was a gift from Bo Huang (Addgene plasmid # 70219). 2PH-PLCdelta-GFP was a gift from Sergio Grinstein (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478) and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453). Lentivirus was generated as described previously (Ferraiuolo et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... High titer (>1012GC/ml) AAV2/1-hSyn-Cre-WPREhGH virus (Addgene 105553-AAV1) was diluted 1:8 or 1:4 in 0.9% saline and 1µl was injected under the forepaw skin ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Rab1060 was obtained from Addgene (#49472) and pET17b-Kif5b(1-560)-GFP-His61 was obtained from Addgene (#15219).
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid pCMV delta R8.2 encoding HIV-1 GagPol (Addgene, plasmid #12263) using Fugene 6 (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV9-CaMKIIα-hChR2(E123A)-EYFP (titer: 1×1013 viral genomes/mL; Addgene: 35505); GAD1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nontargeting shRNA pLKO.1-blast-SCRAMBLE was obtained from Addgene (Catalog #26701). Two shRNAs for each target were obtained and stable lentiviral transductions with the targeted shRNAs and the scramble control were performed ...
-
bioRxiv - Cell Biology 2021Quote: ... The Lentiviral backbone transfer plasmid p-lentiCRISPR - EGFP sgRNA 1 (Addgene Cat #51760) was used to express human codon-optimized Cas9 protein ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were transfected with GFP-swiprosin-1 and GBP-Apex (Addgene plasmid 67651) constructs using a Neon transfection system (as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID: 19119) (36) ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells were transduced with lentivirus packaged with pLentiCas9-Blast (Addgene, 52962) generated from HEK293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... the AAV11 Cap fragment was inserted into pAAV-RC2/1 vector (Addgene, #112862) by T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392); pMDLg/pRRE (gift from Didier Trono ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guide RNA (supplementary table 1) were cloned into pCFD3-dU6:3gRNA (Addgene 49410) digested by BbsI using annealed oligonucleotides ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-hSyn-hChR2-eYFP (UPenn Vector Core AV-1-26973P / Addgene 26973-AAV1) or AAV1-CamKIIa-hChR2-mCherry (UPenn Vector Core AV-1-26975 / Addgene 26975-AAV1 ...
-
bioRxiv - Neuroscience 2021Quote: ... or control virus (AAV8-hsyn-DIO-mCherry) (1×1013 VG/ml; Addgene, 50459) into 3 NBM/SI sites (350 nl/site ...
-
bioRxiv - Microbiology 2021Quote: ... and a plasmid pCMV delta R8.2 encoding HIV-1 GagPol (Addgene, plasmid # 12263) using FuGENE 6 (Promega ...
-
bioRxiv - Bioengineering 2021Quote: ... we injected AAV1-Syn-GCaMP6s-WPRE375-SV40 virus (Addgene, 100843-AAV1, 1×1013) into the visual cortex of the C57BL/6 mice 2-3 weeks before the in vivo imaging experiments ...
-
bioRxiv - Molecular Biology 2020Quote: ... The annealed oligos were diluted (1:200) and cloned into lentiCRISPRv2 (Addgene # 52961) using a Golden Gate Assembly strategy (containing ...
-
bioRxiv - Neuroscience 2021Quote: ... 500–550 nl of AAV9-Syn-jGCaMP7f-WPRE virus (diluted 1:2; Addgene) was injected in dorsal CA1 to express synapsin-driven calcium sensor jGCaMP7f (injection coordinates ...
-
bioRxiv - Developmental Biology 2021Quote: ... Guide RNA (Supplementary table 1) were cloned into pCFD3-dU6:3gRNA (Addgene 49410) digested by BbsI using annealed oligonucleotides (Integrated DNA Technology™) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cloning of shRNAs was conducted according to the pLKO.1 protocol (Addgene 2006). YAP 6SA was subcloned into pLJM1 by PCR amplification using primers (For ...
-
bioRxiv - Systems Biology 2023Quote: ... 31 were transduced with pLenti PGK V5-luciferase (w528-1) blast (Addgene #19166) and selected with 10 µg/ml blasticidin (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127) was injected bilaterally into the PVH of MC4R-2A-Cre mice (150 nl ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mKate2-biPAC (Boston Children’s Hospital Vector Core; Addgene 169127), together with either AAV1-Syn-Flex-GCaMP6s-WPRE-SV40152 (Addgene 100845-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... ≥ 1 x 1013 vg/mL) or AAV1-Ef1a-DIO eNpHR 3.0-EYFP (Addgene: 26966-AAV1 ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371 ...