Labshake search
Citations for Addgene :
1001 - 1050 of 2656 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... or pCAS9- mCherry-Frame +1 plasmid (for conventional CRISPR-Cas9, Addgene #66940), together with 10 μg PiggyBac transposon system (5 μg transposase + 5 μg hygromycin resistance containing transposon)8 were co-electroporated into human duodenum ...
-
bioRxiv - Immunology 2024Quote: ... mTagRFP-Membrane-1 was a gift from Michael Davidson (Addgene plasmid # 57992), and we replaced mTagRFP with mApple to construct the mApple-Mem plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... specifically the pLenti PGK Blast V5-LUC (w528-1) plasmid (Addgene #19166). The process involved using SalI-HF (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... and pGEX-6P-1-INTS3-FL were gifts from Yuliang Wu (Addgene plasmids #128307 ...
-
bioRxiv - Biophysics 2024Quote: ... The transfer vector consisted of a modified pLKO.1 neo plasmid (Addgene) with expression of the shRNA sequences under control of 3× copies of the lac operator ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-Syn-Flex-GCaMP6m-WPRE-SV40 (1×10¹³ vg/ml, Addgene 100838).
-
bioRxiv - Neuroscience 2023Quote: ... all NLS tagged RFP constructs with p-EGFP-N1 (Addgene; 6085-1). To qualitatively verify Cre-dependent ArgiNLS variant expression ...
-
bioRxiv - Cell Biology 2023Quote: ... Annealed oligonucleotides were inserted into the pLKO.1-Hygro vector (#24150, Addgene) digested with AgeI and EcoRI ...
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Cancer Biology 2024Quote: ... shp53 pLKO.1 puro was purchased from Addgene (19119) (shp53 pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 19119 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pLenti-CMV/TO-SV40 small + Large T (w612-1) (#22298, Addgene), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-EF1a-fDIO-mCherry (1 × 1013 vg/ml, 100nl unilateral, #121675, Addgene), AAVrg-EF1a-DIO-FLPo-WPRE-hGHpA (titer 1.6 × 1013 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: Burrhole injections of viral constructs [rAAV2/1&2.hSyn.SIO-eOPN3-mScarlet (Addgene 125713 diluted to 6 × 1012 viral genomes/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-1:PXN-EGFP (Addgene plasmid #87420; http://n2t.net/addgene:87420; RRID:Addgene_87420), AICSDP-10:LMNB1-mEGFP (Addgene plasmid #87422 ...
-
bioRxiv - Genetics 2023Quote: ... 2.5 μg of DNA (1 μg of mCherry-expressing plasmid (Addgene, 72264), and 1.5 μg of either pcDNA4/TO-eGFP ...
-
bioRxiv - Genomics 2023Quote: ... were each cloned into pLKO.1 puro lentiviral vectors (Addgene cat. #8453). Lentiviral particles containing each of the shRNA constructs were generated by calcium phosphate co-transfection of HEK 293T cells with the shRNA pLKO.1 puro vectors and separate pMDLg/pRRE packaging and pCMV-VSV-G envelope plasmids generously provided by Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... specific shRNAs were cloned into the pLKO.1 TRC plasmid (Addgene #10878), where the puromycin resistance cassette was replaced by the cDNA coding for DsRed-Express2 ...
-
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neuronsbioRxiv - Cell Biology 2024Quote: ... pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453)54 ...
-
bioRxiv - Microbiology 2024Quote: ... with the pLenti CMV puro DEST w118-1 plasmid (Addgene #17452, [124]) via LR clonase (Gateway™ LR Clonase™ II Enzyme mix ...
-
bioRxiv - Neuroscience 2024Quote: ... with 1µl of AAV9-CaMKII-GCaMP6f (Addgene, #100834-AAV9, dilution 1/15) at 0.75µl.min−1 (microinjection pump ...
-
bioRxiv - Molecular Biology 2024Quote: ... The hANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
bioRxiv - Neuroscience 2024Quote: ... were subcloned to following vectors: 1.) pCAG-ires-GFP vector (Addgene #45025) with EcoRI and NotI sites for cell electrophysiology experiments ...
-
bioRxiv - Genomics 2024Quote: Two vector systems: (1) CMV-rtTA-HygR vector (Addgene, Cat No.102423) / and (2 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed mCherry-tagged ATG13 (1-191aa) from a pCAG backbone (RRID:Addgene_223759) together with GST-TEV-ATG101 (RRID:Addgene_171414) ...
-
bioRxiv - Cancer Biology 2024Quote: ... constructs including H2B-iRFP670-p2a-mCerulean-Cdt1 (a.a.1–100) (Addgene, 223965), H2B-iRFP670-p2a-mCerulean-Geminin (a.a.1–110 ...
-
bioRxiv - Cancer Biology 2024Quote: ... MOLM-13-luc cells (1 × 104) stably expressing luciferase reporter (Addgene #46793) were injected through tail vein ...
-
bioRxiv - Neuroscience 2020Quote: ... These vectors are pCXLE- hOCT3/4-shp53-F (Addgene, Watertwon ...
-
bioRxiv - Cell Biology 2020Quote: ... A pMXs retroviral vector encoding human OCT3/4 (RRID:Addgene_17217), human SOX2 (RRID:Addgene_17218) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of pCMVR8.74 packaging vector (Addgene plasmid #22036) and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
bioRxiv - Microbiology 2023Quote: ... described in(4) and obtained from Addgene (plasmid # 115809) to produce the HIV-1 LTR-eGFP virus ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene). Mice were also injected unilaterally in the mPFC (1.7 anterior-posterior (AP) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (Addgene, 83897-AAV9) viruses were injected in C57Bl6-Jax mice or in some cases in rats ...
-
bioRxiv - Neuroscience 2024Quote: pENN.AAV9.CamKII.4.eGFP.WPRE.rBG (Addgene viral prep # 105541-AAV9) was added to the cortical organoids at day 278 (1.68×108 GC/well) ...
-
bioRxiv - Synthetic Biology 2024Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(W276A/I279A/I307A/V310A)-GFP (ΔLIR1+4) (RRID:Addgene_223781), BCL2L13(I224A/L227A/W276A/I279A/I307A/V310A)-GFP (ΔLIR1+3+4 ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg pT3 EF1a-MYC (Addgene plasmid # 92046) and 1 μg CMV-SB10 (Addgene plasmid # 24551 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’-entry vector pENTR5’-ubi (ubiquitin promoter) (Addgene plasmid #27230 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µg VSV-G (pMD2.G, Addgene #12259) and 3.3 µg of plasmid of interest ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Glut2 in pX330S-5 (Plasmid #58781, Addgene). Then ...