Labshake search
Citations for Addgene :
1001 - 1050 of 2504 citations for Monoisononyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... AAV CAG-tdTomato (AAVrgTdT; Addgene 59462-AAVrg; 3μl of 4.6 x 1012 GC/ ml). Mice were split into 3 groups whereby group 1 had both vagi intact ...
-
bioRxiv - Neuroscience 2023Quote: ... or pGP-AAV1-syn-FLEX-jGCaMP7f-WPRE (titre 2.1 x 1013 vg/ml, Addgene). 6s and 7f dopamine recordings were pooled in presented analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... 300uL of AAVrg-Ef1a-mCherry-IRES-Cre-WPRE (Addgene 55632-AAVrg, 1.7x1013 vg/mL) was injected unilaterally into either left NAc (AP ...
-
bioRxiv - Neuroscience 2023Quote: ... pCyPet-Rac1(T17N)) and AAV-GFP (pAAV.CMV.PI.EGFP.WPRE.bGH; 1.6x1013 vg/ml) were purchased from Addgene. AAV-GFP was diluted to match the concentration of AAV-Rac1-DN.
-
bioRxiv - Synthetic Biology 2024Quote: Phagemid-containing supernatants were added to 2.5 mL S2060 cells (streptomycin-resistant, Addgene #105064) grown to OD600 = 0.5 and allowed to infect at 37 °C and 250 rpm for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 5 OTp-hM3Dq-Myc (2.9 × 1012 gp/mL) (Corresponding plasmid: Addgene #184753)84
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, 44361-AAV8, 2.9 x 1013 vg/ml) or AAV8-hSyn-DIO-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (viral titer/ml: 3.2 x 10^13, Addgene 100854-AAV9), pCAG.DIO.GPHN.FingR.EGFP2F (viral titer/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Neuroscience 2024Quote: Calcium indicator GCaMP6f (AAV1-Synapsin-GCaMP6f-WPRE-SV40, Addgene 100837-AAV1; 6.52 ×1012GC/ml) was injected using the same procedure at 4.5-5 months after injection of AAV-GFAP-htTau or AAV-GFAP-Control ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV1-CAG-FLEX-tdTomato (Addgene 28306-AAV1; titer: 1.0 x 1012 vg/mL) into bilateral BLA at coordinates anteriorposterior (AP) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-phSyn1(S)-FLEX-TdTomato-T2A-Syp-EGFP (Addgene #51509, 4 x 1014GC/mL) was injected (60nL at 20nL/min ...
-
bioRxiv - Neuroscience 2024Quote: ... 1μL of AAVrg-hSyn-hM3D(Gq)-mCherry (Addgene, #50474-AAVrg, 2.5×1013 GC/ml) or AAVrg-hSyn-hM4D(Gi)-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-Syn-Chronos-GFP (Chronos, 2.90e+13 gc/mL, 250 nL, Addgene #59170-AAV1), AAV-syn-FLEX-jGCaMP7b-WPRE (FLEX-GCaMP7b ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...
-
bioRxiv - Systems Biology 2021Quote: ... We generated two independent miR-290-295_KO mESC lines by transfecting WT E14 mESCs with pX458-sgRNA_miR290-295_3/2 for KO1 (Addgene #172711, #172710) and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710) ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Two closely spaced NHSL1 specific sgRNA (sgRNA1: caccgTCGACTCTCCTCGTCCAAGT; sgRNA2: caccgCTGTCCACTACACGGCACCA) were designed using http://crispr.mit.edu and cloned into pX330S-2 (Addgene 58778) and pX330A_D10A_x2 (Addgene 58772 ...
-
bioRxiv - Molecular Biology 2022Quote: The lentiviral vectors pLVX-EF1alpha-IRES-Puro-2xStreg-SARS-CoV-2 (Nsp6, Nsp8, M) (Addgene plasmids #141395, #141372, #141374) were transfected into the HEK293T cells with packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068 ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Immunology 2021Quote: ... Virus was harvested from GP-2 cells transfected with SINV vectors and VSV-G (pMD2.G, Addgene plasmid #12259) and grown in DMEM supplemented with 30% FBS and 2mM glutamine ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs from the library (Supplemental Table 2) were annealed and cloned into a pLKO.1_neo plasmid (a gift from Sheila Stewart; Addgene plasmid # 13425 ...
-
bioRxiv - Neuroscience 2020Quote: ... mEos3.2-C1 was a gift from Michael Davidson & Tao Xu (Addgene plasmid # 54550; http://n2t.net/addgene:54550; RRID: Addgene_54550). Vcl-T-mEOS3.2-LifeAct was generated by sub-cloning a Vcl-T-T2A fragment in mEOS3.2-LifeAct clone.
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260), and pMD2G envelope plasmid (4 µg ...
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagging of the endogenous locus of SMC3 was done according to the CRISPaint protocol57 using 2.5 μg frame selector plasmid (pCAS9-mCherry-Frame+2; Addgene_6694157), 2.5 μg target selector plasmid (pCS446_pSPgSMC3 ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Systems Biology 2023Quote: ... psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260)) ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255; http://n2t.net/addgene:141255; RRID: Addgene_141255). NSP1 coding sequence was cloned into the mammalian expression pCDNA5-FRT/TO-2xSTREP-3xHA vector ...
-
bioRxiv - Neuroscience 2023Quote: ... and after 2 weeks of expression injected AAV8-EF1a-Con-Foff 2.0-GCamp6m-WPRE into PL (Addgene 137120-AAV8). For recordings from PL-VTA neurons ...
-
bioRxiv - Cell Biology 2023Quote: ... were ordered from Sigma Aldrich as oligonucleotides (Table 2) and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138 ...
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... PLD3 KO cell line was generated from HEK293BlueTM hTLR9 by transfecting 2 μg hSpCas9-sgRNA expressing plasmid (Addgene #99154) cloned with gRNA sequence 5′-guccucauucuggcgguugu-3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were produced in HEK293T cells using packaging and envelope constructs pCMVΔ8.2 and pMD.G-VSV-G (pCMVΔ8.2 and pMD.G-VSV-G were gifts from Bob Weinberg, Addgene plasmids #8454, #8455), and concentrated using fast-trap virus purification and concentration kit according to manufacturer′s instructions (Millipore) ...
-
bioRxiv - Molecular Biology 2020Quote: ... residues 1-271 (Addgene #138421), and residues 1-133 (Addgene #138422 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PLKO.1 (Addgene, #10878 [34]), for expression of Cas12a gRNAs ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #1 (TRCN0000281950, Addgene #136584), shNRF2 #2 (TRCN0000284998 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #1 (TRCN0000416347, Addgene #136581), shJUND #2 (TRCN0000416920 ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µg psPAX2 (Addgene, 12260), 2 µg lentiviral plasmids and 10 µl dH2O was further added with 150 µl serum free DMEM and 9 µl X-tremeGENE HP DNA Transfection Reagent (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.shNkx2-1 (Addgene Plasmid #32400) or pLKO.shScramble (Addgene Plasmid #1864 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 Lentiviral constructs (Addgene) were transfected into 293FT cells using 35μg polyethylenimine per transfection (Alfa Aesar) ...
-
bioRxiv - Cell Biology 2020Quote: pLKO.1 puro (Addgene #8453) was modified to carry:
-
bioRxiv - Neuroscience 2022Quote: pLKO.1-TRC (Addgene, 10878) vector was used for the knockdown of YTHDF2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The pLKO.1 (Addgene #8453) lentiviral vector was digested with AgeI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1.syn.jGCaMP7s 50 (Addgene, 104487-AAV1 ...