Labshake search
Citations for Addgene :
1001 - 1050 of 2937 citations for 3 Methyl 1 6 naphthyridine 2 carboximidamide hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Lentivirus-derived VLPs were produced by transfecting 10 cm dishes of HEK293T LentiX cells with lentiviral packaging plasmids encoding Gag/Pol (pMDLg/pRRE, 15 µg) and Rev (pRSV-REV, 6 µg) (Addgene plasmids 12251 and 12253) together with vectors expressing SARS-CoV-2 Spike (13 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN or non-targeting-control (see Table 3) were cloned into pLKV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene ID:67974) and Cas9 expressing cell lines were transduced and selected with puromycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR and products were cloned into NheI and EcoRV restriction sites (Table 3: marked with blue) of pcDNA3.1-hygro vector (Addgene, kindly provided by Mark Richards-Bayliss group ...
-
bioRxiv - Genomics 2021Quote: ... we performed 80 co-transfections of HeK293T virus packaging cells (at approximatelly 60-70% confluence on 10 cm dishes) with 3 μg of the pDECKO_mCherry plasmid library and 2.25 μg of the packaging plasmid pVsVg (Addgene 8484) and 750 ng of psPAX2 (Addgene 12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and Flailer primary neuronal cultures were infected at 3 DIV with AAV coding for GCaMP6s (Addgene #51086) and FL1 or control AAVs ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Cell Biology 2022Quote: ... the full-length dFz2 ORF was amplified and then mScarlet-I was fused to its 3’ end (Addgene #85044). The dFz2-Scarlet fusiomn was then cloned into the UASp vector ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3.7 μg pLenti6.3-HA-NL-tetraspanin plasmids or pLenti6.3-CD63-pHluorin plasmid were co-transfected with 0.9 μg pREV (Addgene, 12253) and 1.8 μg pRRE (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542; http://n2t.net/addgene:62542; RRID: Addgene_62542). 250 ng/μl of Cas9 mRNA and 50 ng/μl of gRNA(s ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Genetics 2023Quote: ... and a 3’ UTR harboring the WPRE element was cloned in the pT7-PEmax for IVT plasmid (Addgene 178113)2 ...
-
bioRxiv - Immunology 2022Quote: ... and mSGK3 exon 3 (TTCAAGACATTAAATGCAG) were designed using the online tool CHOPCHOP (http://chopchop.cbu.uib.no/) and cloned into TLCV2 (Addgene plasmid # 87360,) as described previously5455 ...
-
bioRxiv - Plant Biology 2022Quote: The longer and shorter transporter 3′ UTRs were cloned into the dual luciferase construct pGreen_dualluc_3′UTR_sensor at EcoRI sites (Addgene, Cat: 55206). The longer 3′ UTRs without AU-rich elements were amplified using flanking PCR methods ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was injected into worms along with a plasmid containing transposase (pCFJ601, Peft-3::Mos1 transposase, Addgene #34874) and co-injection markers (pGH8 Addgene #19359 ...
-
bioRxiv - Neuroscience 2024Quote: ... P1-3 pups were injected with 360 nL of AAV1-FLEX-tdTomato (titer: 2.5×1013 vg/mL, Addgene #28306) per cortical hemisphere ...
-
bioRxiv - Molecular Biology 2024Quote: ... and subsequently fused in-frame with the GFP reporter gene with unc-54 3′UTR which was amplified from pPD95.75 plasmid (Addgene) using GFP_C and GFP_D primers (Table S1) ...
-
bioRxiv - Neuroscience 2024Quote: ... NTC-R aaactaaaccaggtgcctcagccgc-3′) were then annealed and cloned into the BsmBI cloning site of lentiGuide-puro (Addgene #52963) plasmid that contains a U6 promoter driving the expression of the specific P2ry13 or NTC gRNA ...
-
bioRxiv - Plant Biology 2024Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Supplementary Table 3) were individually inserted downstream of the U6 promoters in the corresponding plasmids: pMJ114 (bovine U6; RRID:Addgene_85995), pMJ179 (mouse U6 ...
-
bioRxiv - Developmental Biology 2024Quote: ... P{w[+mC]=UAS-FLAG-HA-FP4mito}3 (Bloomington Cat#58481; RRID:BDSC_58481) and Halo7 was amplified from UAS-7xHalo7::CAAX (Addgene # 87647) (Sutcliffe et al ...
-
bioRxiv - Genetics 2020Quote: ... Ishikawa cells were plated at a density of ~300,000 cells per well in 6 well plates and transfected the following day with 1650 ng Cas9 plasmid (Addgene 62988, a gift from Feng Zhang), 550 ng of each guide RNA (Table S2) ...
-
bioRxiv - Bioengineering 2020Quote: ... and a kanamycin resistance (from the plasmid pBBR1MCS-2 (55) purchased from Addgene 85168) ...
-
bioRxiv - Genetics 2021Quote: ... daf-16 (#34833) and daf-2 RNAi (#34834) clones were obtained from Addgene. mbl-1 RNAi was cloned from C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259)) mixed in 0.45 mL water ...
-
bioRxiv - Cell Biology 2022Quote: ... pmTurquoise2-Golgi was a gift from Dorus Gadella (Addgene plasmid # 36 2 05)32 ...
-
bioRxiv - Cancer Biology 2021Quote: ... annealed in vitro and subcloned into BsmbI-digested lentiCRISPRv.2-puro (Addgene 52961) or lentiCas9-Blast (ULK2 sgRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... , (2) nlsLexA::GADfl ORF was amplified from pBPnlsLexA::GADflUw (Gerald Rubin54, Addgene-26232), and (3 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Pmyo-2::mCherry co-injection marker (2.5 ng/μl; pCFJ90, Addgene #19327) were micro-injected in the gonad of young adults ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... annealed in vitro and subcloned into BsmbI-digested lentiCRISPRv.2-puro (Addgene 52961) or lentiCRISPRv.2-hygro (Addgene 98291) ...
-
bioRxiv - Cell Biology 2022Quote: ... Number of pulses: 2×106 cells were transfected with ING2-PHD_GFP (Addgene, #21589) or pCSDEST2_NLS-GFP (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT Δ(2-15)-3F pCW57.1 was generated using the pCW57.1 (Addgene, #41393) plasmid backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... 2×106 cells were transfected with 5ug pCBA-I-SceI plasmid (Addgene #26477), 40nmol siRNA and 1ug Cerulean-c1 plasmid (Addgene #54604 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and pLVX-EF1alpha-SARS-CoV-2-Nsp2-2XStrep-IRES-Puro plasmid (Addgene, 141368) were obtained from Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... pENTR4-FLAG (w210-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17423 ...
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259) mixed in 0.45 mL water ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 μg of VSV-G envelope expressing plasmid (pMD2.G, Addgene #12259), and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G ...