Labshake search
Citations for Addgene :
801 - 850 of 2937 citations for 3 Methyl 1 6 naphthyridine 2 carboximidamide hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... plasmids pTwist-SARS-CoV-2 d18 B.1.617.2v1 (Addgene #179905) and pTwist-SARS-CoV-2 d18 B.1.1.529 (Addgene #179907 ...
-
bioRxiv - Bioengineering 2024Quote: ... derived from Prime editor 2 system (PE2, Addgene plasmid #132775) 15 ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAV-flex-GCaMP6f (Addgene #100833, 2 × 1013 gc/mL) was injected into the PL ...
-
bioRxiv - Cancer Biology 2024Quote: ... and WPMY cells were overexpressed with Wnt-2 (Addgene 43809). All flag plasmids were manufactured by Gene Universal ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resin was washed 6 times with lysis buffer (supplemented with 100 nM USP2 (purified in-house from Addgene plasmid 36894) for de-ubiquitinated TOP2B) ...
-
bioRxiv - Cell Biology 2022Quote: ... the following packaging and envelop plasmids were added to all of the 10-cm dishes as well: psPAX2 (6 μg) and pMD2.G (0.75 μg, Addgene, catalog #: 12259). psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... approximately 500,000 cells in 6-well plates were transfected with 2000ng dCas9-KRAB-MeCP2-containing PiggyBac expression plasmids (Addgene plasmid #110821) and 400ng of transposase vector PB200PA-1 using PEI ...
-
bioRxiv - Genetics 2021Quote: ... 2 ml (1.5× 106/ml) cells plated in a well of a 6-well dish were transfected with 300 ng of Act::Cas9 (Addgene #62209) and the respective gRNA and repair templates for the 25C6 (75 ng pU6-3-25C6-gRNA1 (DGRC Cat# 1547) ...
-
bioRxiv - Immunology 2021Quote: ... Platinum-E cells were transfected at 70-80% confluency on 10 cm plates with 4 μg pCL-Eco(40) and 6 μg of either pMSCV-pBabeMCS-IRES-RFP (Addgene; 33337) or pMSCV-Myc-IRES-RFP (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... were electroporated (6 square wave pulses, 0.1ms interval, 175V) with a pX458 vector (a gift from Feng Zhang; Addgene plasmid #48138) containing an Rpl10 targeting gRNA (5’-TGATACGGATGACATGGAAA-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... Additional viral constructs were assembled for Cre-dependent expression of a reporter under the control of the Dlx5/6 enhancer: AAV-Dlx-Flex-GFP (Addgene #83900) and AAV-Dlx-Flex-ChR2-mCherry (Dimidschstein et al. ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 x 106 cells were transfected using the calcium phosphate precipitation method (Salmon and Trono, 2007) with 6 μg pMD2.G (Addgene #12259), 15 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice were generated by subcloning an N-terminal 3x HA-tagged CIC-DUX4 fusion gene from Yoshimoto et al.6 into a Rosa26 targeting construct (Addgene #21714). The sequence verified construct was then transfected into ES cells and selected in G418 media ...
-
bioRxiv - Genetics 2023Quote: We plated 550,000 HEK293T cells on 6-well plates and 24 hours later we transfected the cells with 900 ng psPAX2 packaging vector (Addgene #12260), 360 ng pMD2.g VSV-G envelope vector (Addgene #12259) ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were seeded at a confluency of ∼70 % in T75 flasks and co-transfected 6 hours later with 7.5 µg of the lentiviral packaging vector psPAX2 (gift from Didier Trono - Addgene plasmid # 12260) and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Immunology 2024Quote: ... HEK293Ts at >70% confluency in a 6-well TC-treated plate were transfected with 0.468 μg VSV-G (pMD2.G, Addgene plasmid #12259), 1.17 μg D8.9 packaging vector ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus expressing either Bmal1- or Per2-promoter driven luciferase reporter was produced by transfecting HEK293T cells with 6 µg psPAX2 (Addgene #12260), 3.6 µg pMD2G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2024Quote: hCMEC/D3 brain endothelial cells were grown to confluency in 6-well culture plates and transfected with 1µg of a β-Catenin luciferase reporter plasmid (M50 Super 8x TOPFlash - Addgene #12456) and 35ng of Renila reporter plasmid (pRL-TK Promega #E2231 ...
-
bioRxiv - Genomics 2024Quote: ... HEK293 cells were seeded at 1.2×106 cells per well of 6-well plate and transfected with pMD2.G (Addgene plasmid # 12259), pCMVR8.74 (Addgene plasmid # 22036 ...
-
bioRxiv - Cancer Biology 2024Quote: ... a NALM-6 clone bearing an integrated doxycycline-inducible Cas9 expression cassette generated by lentiviruses made from pCW-Cas9 (Addgene #50661) was transduced with the genome-wide KO EKO sgRNA library83 (278,754 different sgRNAs) ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus particles were generated by co-transfecting HEK293FT cells (10 cm dish at 80% confluency) with 6 μg of lentiviral overexpression plasmid with 4 μg psPAX2 packaging plasmid (Addgene #12260) and 0.8 μg pMD2.G envelope plasmid (Addgene #12259 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Neuroscience 2022Quote: ... The loops were shuttled into pCSF107mT-GATEWAY-3’-3HA (gift from Todd Stukenberg, Addgene plasmid # 67616) using Gateway LR clonase ...
-
bioRxiv - Immunology 2020Quote: ... Guide sequences (listed in Supplementary Table 3) were cloned into the lentiCRISPR v2 plasmid (Addgene #52961) and lentiviral particles were generated in 293T cells (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 HRE luciferase cells were generated by co-transfection of 3xHRE-luciferase construct (Addgene 26371) with a puromycin-resistant construct ...
-
bioRxiv - Neuroscience 2022Quote: [3] ie1: An enhancer/promoter from pGL3-IE1 (a gift from Zach Adelman, Addgene ID #52894) (Anderson et al. ...
-
Improving the efficacy and accessibility of intracranial viral vector delivery in non-human primatesbioRxiv - Neuroscience 2022Quote: ... Subjects MTL1-3 were infused with two retrograde viruses (gifted from Edward Boyden & Karel Svoboda; Addgene viral preps #59170-AAVrg & #29017-AAVrg ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.CamKII(1.3).eYFP.WPRE.hGH was a gift from Karl Deisseroth (Addgene plasmid# 105622; http://n2t.net/addgene:105622; RRID:Addgene_105622).
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... and (3) GFP1-10 from pFA6a-link-yGFP1-10-CaURA3MX (Addgene 86419; (Smoyer et al., 2016)) and subsequent cloning into the XhoI/NotI sites of pRS304 mito-DsRed.
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene, #78534). The puromycin resistance cassette in pLentiCRISPRv2 was replaced by a GFP gene using standard cloning techniques ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-GAL4DBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-VP16 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Neuroscience 2024Quote: USP14_Reverse: 5’ AAACCCAATGGTATTCAAGGCTCACC 3’ were cloned into pSpCas9(BB)-2A-Puro vector (PX459, 62988, Addgene, USA) using FastDigest BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles containing the sgRNA against mouse Rap1 (target: 5’-GCAGTCTAGGATGTACTGCG-3’) in lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2024Quote: Full-length human CEP152 with gRNA resistance (5’-CAGAACAGTTAGAAATGAGT-3’) in pAID 1.1C-T2A-Bsr (Addgene) and CEP152D43/44A in pEGFP-C1 were synthesized by GenScript ...
-
bioRxiv - Cell Biology 2024Quote: ... reverse primer: 5’-ATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC-3’) and cloned into pLentiCRISPRv2-Opti (a gift from David Sabatini; Addgene plasmid # 163126 ...
-
bioRxiv - Cell Biology 2020Quote: ... and transfected at 4-6 h with a plasmid encoding HA-Separase (pCS2+HA-hSeparase was a gift from Marc Kirschner, Addgene plasmid # 33018), Plk1TD expression was induced 8-10 h after shake off and cells were fixed at 28 h to analyze distancing or at 32 h (20 h of S phase arrest ...