Labshake search
Citations for Addgene :
1001 - 1050 of 1237 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... male mice first received bilateral injections of virus (AAV2/5-ef1α-FLEX-taCasp3-TEVp, Addgene, 45580) into the caudolateral PAG (day 0) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 × 106 cells were co-transfected with 5 µg of eSpCas9-hGeminin plasmid (Addgene plasmid, #86613) and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... AAV2 rep genes and adenovirus serotype 5 helper genes (gift from David Russell - Addgene plasmid #110660).62 Particles were harvested after 72 h ...
-
bioRxiv - Cell Biology 2020Quote: ... pLenti [CM V/GFP/Hygro] (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17446). The cut backbone vector was treated with Antarctic Phosphatase (cat# M0289S ...
-
bioRxiv - Neuroscience 2021Quote: ... Subset of pups were bilaterally injected with 4 μl AAV9-hsyn-EGFP (3.4×10^13 gc/ml, Addgene) or 4 μl ACh3.0 (1.8×10^13 gc/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446; http://n2t.net/addgene:17446; RRID:Addgene_17446)65 ...
-
bioRxiv - Biochemistry 2022Quote: HEK293T cells were transiently transfected with pGP-CMV-GcAMP6s (Ca2+ Sensor plasmid, Addgene, Cat. no. 40753; 4 µg), 5HT2c receptor (as positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and subcloned into pLenti-CMV-GFP-Hygro (656-4) (gifted from Eric Campeau & Paul Kaufman; Addgene plasmid # 17446) using NEBuilder® HiFi DNA Assembly Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: The genome-wide Brie CRISPR-KO library (4 sgRNAs per gene; ~ 80.000 sgRNAs) was purchased from Addgene (#73632) and amplified according to the supplier’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection was performed with control vector (pcDNA/GW-40/LacZ) or 4 μg pARID1A (Addgene catalogue number 39311) using FuGENE 6 Transfection Reagent (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... Electrocompetent BW25113 cells were co-transformed with the pORTMAGE-4 plasmid (Addgene plasmid #72679, courtesy of Csaba Pál) and the pBAD-yTrm5 plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4×105 HEK 293T cells were transfected with pCDH-EF1-sCTLA-4 expression plasmid (1.5 µg) and psPax2 (2 µg) and pMD2.G (1.5 µg) packaging plasmids (Addgene), using Viafect™ (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Neuroscience 2022Quote: ... Pups were injected bilaterally with 4 ul of AAV9-hSyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene). Mice also received an injection of AAV9-hSyn-GRABACh3.0 to express the genetically encoded cholinergic sensor GRABACh3.0 48 ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259), 10 µg of psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...
-
bioRxiv - Neuroscience 2024Quote: The pAAV-hSyn-DIO-hM4D(Gi)-mCherry (DREADD virus) (4*10^12 gc/ml, Addgene, United States, addgene.org) or pAAV-hSyn-DIO-mCherry (4.2*10^12 gc/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... or the control reporter mCherry (AAV5-hsyn-DIO-mcherry, Addgene #50459 titre: 1:4 – 7×10¹² GC/mL).
-
bioRxiv - Systems Biology 2022Quote: ... we first prepare the vector backbone by incubating 5 ug of PB-TRE-dCas9-VPR (Addgene #63800) for 2 h at 37°C with 2 ul of FastDigest FspAI (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μl of AAV2/5-GfaABC1D-Lck-GCaMP6f (1013 genome copies/ml) (Addgene viral prep # 52924-AAV5) was injected into the DLS ...
-
bioRxiv - Neuroscience 2021Quote: pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (titer ≥ 1×1013 vg/ml, working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9 ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were transduced with floxed jGCaMP7b (AAV1-syn-FLEX-jGCaMP7b-WPRE; Addgene #104493, MOI = 5×105 vg) [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2022Quote: ... Circuit-specific viral expression was achieved using the retrograde properties of adeno-associated virus (AAV) serotype 5 23: AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540). Sparse labelling was obtained using Cre-inducible ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9; https://www.addgene.org/100833/RRID:Addgene_100833) was injected unilaterally into the DS (L = ±1.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Animals received a single dose of AAV8.TBG.null or AAV8.TBG.p21 (5*10^12 units/ml) (Addgene) intravenously allowed 1 week wash-out period on normal diet ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... 400 nl of AAV2/5-CAG-dLight1.1 (1.7×1013 GC/ml, 111067-AAV5, Addgene, Watertown, MA, USA) was slowly injected into the DMS (n = 7 ...
-
bioRxiv - Genetics 2023Quote: ... the FKBP coding sequence was amplified from the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have cloned their respective oligonucleotides in following vectors: PDX1 in pX330A-1×5 (Plasmid #58769, Addgene), NKX6.1 in pX330S-2 (Plasmid #58778 ...
-
bioRxiv - Systems Biology 2024Quote: We established a stable Cas9-expressing line by infecting EpiSC-5 cells with lentiCas9- Blast (Addgene 52962), followed by selection with 5 µg/ml blasticidin (Sigma 15205 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5.CaMKII.tdTomato (Neurophotonics, 661-aav5) was used to label excitatory neurons and AAV9.CaMKII.GCaMP6s.WPRE.SV40 (Addgene, 107790) was employed to image excitatory neuronal calcium activity ...
-
bioRxiv - Neuroscience 2023Quote: ... RRID:Addgene_20297) or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860; http://n2t.net/addgene:55860; RRID:Addgene_55860). Matrix-roGFP (mt-roGFP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the first 639 bp of the 5’ end of p65HSF1 from pAC1393-pmax-NLSPUFa_p65HSF1 (Addgene, #71897). These were then Gibson assembled along with an IDT gBlock containing the last 300 bp of p65HSF1 that had been codon optimised for expression level detection distinct from endogenous mRNA ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5; http://www.addgene.org/52295/; RRID: Addgene_52925) was a gift of Baljit Khak ...
-
bioRxiv - Cell Biology 2023Quote: ... and the sgRNA cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmids were named pGGG-ZIP4-B2 Construct 1 (containing sgRNA 4 and 12 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLenti-ATF4-uORF-GFP reporter plasmid was generated by placing the ATF4 5’UTR from Addgene plasmid #21850 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene, 71814), 500 ng gRNA plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNAs targeting PCNA exon 5 (PCNAex5_gRNA_1: ATACGTGCAAATTCACCAGA; PCNAex5_gRNA_2: GCAAGTGGAGAACTTGGAAA) were cloned into hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). Double-stranded donor plasmids containing the K164R coding mutation (c.491 A>G ...
-
bioRxiv - Neuroscience 2024Quote: ... a volume of 200 nL AAV2/5.hsyn.GcaMP6f.WPRE.SV40 virus or AAV2/5.syn.jGCaMP8s.WPRE (respectively: titer: 1.3*1012 gc/mL; a gift from Douglas Kim & GENIE Project: Addgene viral prep # 100837-AAV5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cloned 5’ to 2xeGFP or 2xmCherry amplified from pHsp83-NLS-HA-2xPCP-2xGFP vector (Addgene #71243) (Halstead et al. ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Bioengineering 2020Quote: ... pCXLE-hMLN and pCXLE-hOCT3/4 that were a gift from Shinya Yamanaka (Addgene plasmid # 27078, 27079 and 27076), according to previously reported papers(80,81) ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259)) were transfected into HEK-293 T cells (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...