Labshake search
Citations for Addgene :
801 - 850 of 1237 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... and 5 μg/flask of psPAX2 (Addgene 12260) using EndoFectin Lenti transfection reagent (GeneCopoeia ...
-
bioRxiv - Immunology 2024Quote: ... with 5 µg of HA-HIF1alpha (Addgene#18949) and HA-HIF1alpha P402A/P564A-pcDNA3 (Addgene#18955) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid, #86551). Cells were electroporated using the Neon Transfection System (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µg of pMD2.G (#12259, Addgene) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...
-
bioRxiv - Biochemistry 2021Quote: ... guide sequences 5’GGCATTGCCCGTCATGGCCC3’ and 5’GTCTTCACCGAGCTCATTAA3’ were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang; Addgene plasmid # 42230) and co-transfected with a GFP-expressing plasmid into HCT116 cells using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Developmental Biology 2024Quote: ... as well as non-targeting control gRNAs80 were synthesized with overhangs (sense: 5′-ACCG, antisense: 5′-AAAC) subcloned into the BsaI sites of pGL3-U6-sgRNA-EGFP (Addgene # 107721)81.
-
bioRxiv - Neuroscience 2020Quote: [4] T2A-GCaMP6s from pGP-CMV-GCaMP6s (Addgene plasmid #40753) with T2A sequence includedintheforwardprimer(underlined ...
-
bioRxiv - Neuroscience 2020Quote: ... two unc-4 sgRNA plasmids and Cas9 plasmid (Addgene #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4 μg of envelope plasmid (pMD2.G; Addgene #12259) with 112 μg PEI MAX (Polysciences ...
-
bioRxiv - Genomics 2022Quote: ... 4 µg of the envelope-encoding plasmid pVSVg (Addgene 12260) and 7.5 µg of the packaging plasmid psPAX2 (Addgene 8454 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were transfected with 4 mg of SNAP-CD59 (Addgene) using Lipofectamine 3000 (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 µg of the viral packing PsPAX (Addgene #12260) plasmids using the Polyfect reagent according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 µg sgRNAb/Cas9 plasmid (Addgene 62988, Supplementary table 6), 200 µl Opti-Mem and 25 µl Lipofectamine 2000 was prepared ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332).
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Cell Biology 2021Quote: ... with 5 µg of Cas9-GFP plasmid (Addgene, 44719), 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre- dependent AAV2/5 hSyn.DIO.hM4D(Gi)-mCherry (Addgene; #44362) expressing the inhibitory hM4Di designer receptor exclusively activated by designer drugs (iDREADD ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 µg packaging plasmid pUMVC (Addgene, Plasmid #8449). Virus particles were collected 48 h after transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg envelope helper plasmid (pMD2.G, Addgene #12259) and 80 μl of 1mg/ml polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.0 μl of AAV2/5.CAG.GCaMP6s.WPRE.SV40 (titer: 1X1013; Addgene) was injected into the left trigeminal ganglion (TG ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μg of either H2B-GFP (Addgene #11680) or H2B-RFP (Addgene #26001 ...
-
bioRxiv - Systems Biology 2023Quote: ... The CRISPRi-v2 (5 sgRNA/TSS, Addgene: Cat#83969) sgRNA library was transduced into Jurkat cells at an MOI < 0.3 (BFP+ cell percentages were ∼30%) ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: 5×NF-κB_RE::RedF (#124530; Addgene, Watertown, MA, USA) is the reporter plasmid consisting of a red firefly luciferase driven by a minimal promoter containing five NF-κB-binding sites (NF-κB-Luc ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µg of phCMV-VSV-G (#8454 Addgene) using calcium phosphate transfection kit (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 μg of the second-generation packaging plasmid psPAX2 (Addgene; 12260), and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lenti dCAS-VP64_Blast (4) was a gift from Feng Zhang (Addgene plasmid # 61425 ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAV2.CAG.tdTomato (Addgene, #59462-AAV2, titer: 4×10¹² vg/mL) were used ...
-
bioRxiv - Plant Biology 2020Quote: ... pICH47742::2x35S-5′UTR-hCas9 (STOP)-NOST (Addgene no. 49771), pICH41780 (Addgene no ...
-
bioRxiv - Neuroscience 2020Quote: ... the AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332), and the AAV2/5-hSyn-hChR2(H134R)-mCherry was purchased from the UNC Vector Center ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 pmol DNA plasmids (1.5 pmol psPAX2 (Addgene #12260), 1.5 pmol pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μg VSV-G expressing envelope plasmid (pMD2.G, Addgene) and 4 μg plasmid of interest (e.g ...
-
bioRxiv - Cell Biology 2023Quote: ... the hCRISPRi-V2 compact library (Addgene #83969, 5 sgRNAs/TSS) was transduced at a MOI (multiplicity of infection <1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the PMD2.G (5 μg) envelope construct (Addgene # 12259) were added to the solution ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076] ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 4 μg of pMD2.G (Addgene #12259), 4 μg of psPAX2 (Addgene #12260 ...