Labshake search
Citations for Addgene :
51 - 100 of 121 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 2μg of both TALEN-L and TALEN-R plasmids (Addgene, #59025 and #59026) and 4µg of pUCM-AAVS1-TO-hNGN2 plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Cre-containing plasmid was obtained from Addgene (pLM-CMV-R-Cre, Addgene #27546). A fragment encoding the CMV promoter and mCherry-T2A-Cre-WPRE was excised by NdeI and SacII (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... RA was PCR amplified from RA-NES (gift from R. Campbell, Addgene plasmid #61019) (Ding et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... GB was PCR amplified from GB-NES (gift from R. Campbell, Addgene plasmid #61017) (Ding et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... and R-CEPIA1er (a gift from Masamitsu Iino, Nihon University, Tokyo, Japan; Addgene plasmid #58216) (Suzuki et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 2011) (pCMV-VSV-G and pLKO.1 puromycin were gifts from R. Weinberg through Addgene), using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... Primers GFP-F-EcoRI and 3xNLS-R were used to obtain GFP-3xNLS from Addgene plasmid pEGFP-C1 EGFP-3xNLS ...
-
bioRxiv - Microbiology 2020Quote: ... The UPS reporter construct Ub-R-GFP was obtained as a gift from Nico Dantuma (Addgene plasmid # 11938 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reporter assays to assess RUNX1 transcriptional activity were done using the pMCSF-R-luc plasmid (Addgene plasmid #12420 ...
-
bioRxiv - Neuroscience 2022Quote: ... The pDisplay-Gncp-iGluSnFR and pDisplay-R-iGluSnFR1 vectors were gifts from Dr Robert Campbell (Addgene plasmid #107337 and #107335 ...
-
bioRxiv - Molecular Biology 2020Quote: 1×106 cells of WTC p42 were transfected with 5mg AAVS1-TALEN R plasmid (Addgene #59026), 5 μg AAVS1-TALEN L plasmid (Addgene #59025) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2012) were cloned into the pLKO.1-Puro vector (a gift from R. Weinberg; Addgene #8453) to generate pLKO.1-Cys-TD and pLKO.1-Scr-TD ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids Ub-M-GFP and Ub-R-GFP were a gift from Nico Dantuma (Addgene #11939) (Dantuma et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... donor construct:each of the site-specific TALENs (TALEN L [Addgene #59025] and TALEN R [Addgene #59026]). The cell suspension with DNA was transferred to R-50×8 Multi-well Processing Assembly electroporation cuvettes ...
-
bioRxiv - Neuroscience 2024Quote: ... donor construct:each of the site-specific TALENs (TALEN L [Addgene #59025] and TALEN R [Addgene #59026]). The cell suspension with DNA was transferred to R-50×8 Multi-well Processing Assembly electroporation cuvettes ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid used for calcium imaging CMV-mito-R-GECO1 was a gift from Robert Campbell (Addgene plasmid #46021 ...
-
bioRxiv - Bioengineering 2020Quote: ... either of the two cell types was subjected to Lipofectamine transfection with CMV-R-GECO1.2-mCherry (Addgene, Watertown ...
-
bioRxiv - Cancer Biology 2021Quote: The M-CSF promoter reporter (pMCSF-R-luc Addgene plasmid # 12420; http://n2t.net/addgene:12420; RRID: Addgene_12420)(Zhang et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... AAVS1-TALEN-L and AAVS1-TALEN-R were gifts from Danwei Huangfu (Addgene plasmid # 59025 and 59026) (González et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: Ub-R-GFP was a gift from Nico Dantuma (Addgene plasmid # 11939; http://n2t.net/addgene:11939; RRID:Addgene_11939). Site directed mutagenesis was performed to generated Ub M-GFP and Ub-L-GFP using Q5 Hot Start High-Fidelity Polymerase New England Biolabs (Ipswich ...
-
bioRxiv - Biochemistry 2021Quote: ... Ub-M–GFP (#11938) and Ub-R–GFP (#11939) plasmids described in [45] were purchased from Addgene. HA tagged USP5 (#22590 ...
-
bioRxiv - Microbiology 2020Quote: ... The UPS reporter construct Ub-R-GFP was obtained as a gift from Nico Dantuma (Addgene plasmid # 11938; http://n2t.net/addgene:11938; RRID:Addgene_11938) and sub-cloned into the pKT3 plasmid using the NheI and SmaI sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reporter assays to assess RUNX1 transcriptional activity were done using the pMCSF-R-luc plasmid (Addgene plasmid #12420; http://n2t.net/addgene:12420; RRID:Addgene_12420) (Zhang et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and nuclear (CMV-NLS-R-GECO) targeted calcium biosensors were gifts from Robert Campbell (Addgene #61244, and 32462) [40,41] ...
-
bioRxiv - Cell Biology 2021Quote: ... the sequence coding for R-GECO1 including TorA-tag from pTorPE-R-GECO1 (a gift from Robert Campbell (Addgene plasmid #32465; http://n2t.net/addgene:32465; RRID:Addgene_32465), and (iv ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK-293 cells were transfected with two plasmid vectors CMV–R-GECO1 (a gift from Robert Campbell, Addgene plasmid #32444 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK-293 cells were transfected with two plasmid vectors CMV–R-GECO1 (a gift from Robert Campbell, Addgene plasmid #32444; http://n2t.net/addgene:32444; RRID:Addgene_32444) and PH(Akt)-Venus (a gift from Narasimhan Gautam ...
-
bioRxiv - Biophysics 2023Quote: ... generated by us in the Kiel center [51] using a modified version of the pHyVec1 plasmid which replaces the GFP sequence with a GCaMP6s sequence that was codon-optimized for Hydra (HyGCaMP6s was a gift from R. Yuste lab (Addgene plasmid # 102558; http://n2t.net/addgene:102558 ; RRID:Addgene_102558) [37]) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The TIS11B coding sequence was amplified from pcDNA3.1-puro-GFP-TIS11B using TIS11B MCP F and TIS11B MCP R primers and the TIAL1 coding sequence was PCR amplified from pFRT_TO_FlagHA_TIAL1 (Addgene 106090) using TIAL1 MCP F and TIAL1 MCP R primers.
-
bioRxiv - Cancer Biology 2023Quote: ... PGL2 E-cad (108) Ebox Mut-Luc (kindly provided Dr. Eric R. Fearon, Addgene plasmids 19291 and 19290), and 0.025 μg of pRL-TK (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... CMV-R-GECO1 (32) and pDDRFP-A1B1-DEVD (75) were gifted by Robert Campbell (Addgene plasmid #32444 and #36294). pcDNA3-HA-human OCRL (76 ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Bioengineering 2020Quote: ... VPR was amplified by primer pair VPR-F/R (template source: pWalium20-10XUAS-3XFLAG-dCas9-VPR (Addgene No.: # 78897)(Lin et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid used for calcium imaging CMV-mito-R-GECO1 was a gift from Robert Campbell (Addgene plasmid #46021; http://n2t.net/addgene: 46021; RRID: Addgene_46021).
-
bioRxiv - Bioengineering 2021Quote: ... R-GECO expression was done with lipofectamine 3000 using the Addgene plasmid CMV-R-GECO-1.2 at 400 ng per sample (Catalog #45494, Addgene), courtesy of Robert Campbell [26] ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Cancer Biology 2021Quote: ... All the sgRNAs were designed using Benchling Life Sciences R&D Cloud Software (https://benchling.com/) and cloned into the pSpCas9(BB)puroV2.0 vector (Addgene #62988), which expresses both Cas9 and puromycin resistance genes23,24 ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... plasmid pU6-BbsI-chiRNA-dilp8_gRNA1 was generated by cloning the annealed primers #200_DILP8-GuideRNA_1_F “CTTCGCACTGGTTTAGACAGCAGT” and #201_DILP8-GuideRNA_1_R “AAACACTGCTGTCTAAACCAGTGC” into BbsI-digested pU6-BbsI-chiRNA [a gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger (Addgene plasmid # 45946 ...
-
bioRxiv - Cell Biology 2021Quote: ... R-GECO and mito-LAR-GECO were gifts from Robert Campbell (University of Alberta, Addgene plasmid 32444 and 61245) (Wu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... NTC-R aaactaaaccaggtgcctcagccgc-3′) were then annealed and cloned into the BsmBI cloning site of lentiGuide-puro (Addgene #52963) plasmid that contains a U6 promoter driving the expression of the specific P2ry13 or NTC gRNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The predicted r-opsin1 TALENs were constructed in vitro using Golden Gate assembly protocol (Golden Gate TAL Effector Kit 2.0, Addgene #1000000024) [88] ...
-
bioRxiv - Plant Biology 2021Quote: ... including a 2385 bp region upstream of the ATG start codon and a 294 bp region downstream of the TAG stop codon was PCR amplified with oligonucleotides MTOPVI-Prom-SalI-F and MTOPVI-Term-NotI-R and cloned between SalI and NotI restriction endonuclease sites into pGreen0029 vector (Addgene), to yield the pGreen-gMTOPVIB construct ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Molecular Biology 2022Quote: ... R179A and R320A were PCR amplified and cloned into pET Strep II co-transformation cloning vector (13S-R, Addgene # 48328). Csb3/I-G was cloned into pQE2 (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nSauCas9D10A plasmid used for the orthogonal R-loop assay was also cloned by SDM using CMV-dSauCas9 (Addgene #138162) as a template ...
-
bioRxiv - Biophysics 2023Quote: ... generated by us in the Kiel center [51] using a modified version of the pHyVec1 plasmid which replaces the GFP sequence with a GCaMP6s sequence that was codon-optimized for Hydra (HyGCaMP6s was a gift from R. Yuste lab (Addgene plasmid # 102558 ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP–Parkin was introduced using retroviral transduction with the pBMN-YFP-Parkin plasmid (gift from R. Youle; Addgene plasmid, 59416), followed by fluorescence sorting ...
-
bioRxiv - Biochemistry 2024Quote: The pNLS-mTagBFP2 plasmid used as an internal control of transfection efficiency was obtained by PCR amplification of the 2xNLS-mTagBFP2 coding sequence with mTagBFP-Acc65-F and mTagBFP-Mlu-R primers on the pHAGE-TO-nls-st1dCas9-3nls-3XTagBFP2 plasmid template (a gift from Thoru Pederson ; Addgene plasmid # 64512 ...
-
bioRxiv - Biochemistry 2024Quote: ... The Cpf1 and guide RNA co-expression plasmid used to cleave the reporter substrate was generated by inserting the pre-annealed gRNA-GF-F and gRNA-GF-R oligonucleotides into the Esp3I restriction sites of pTE4398 (a gift from Ervin Welker ; Addgene plasmid # 74042 ...
-
bioRxiv - Physiology 2024Quote: ... Lyn-R-GECO1 (gift from Won Do Heo (Addgene plasmid # 120410 ; http://n2t.net/addgene:120410 ; RRID:Addgene_120410; (Kim et al., 2016)) ...