Labshake search
Citations for Addgene :
1 - 50 of 121 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and R-GECO1.2 (Campbell R., Addgene plasmid 45494)(Wu et al. ...
-
bioRxiv - Cell Biology 2024Quote: R-GECO1 (Addgene plasmid #32465 ...
-
bioRxiv - Genetics 2023Quote: ... TALEN-R (Addgene #35432) and pJT039 (AAVS1-9xTetO-pEF-IGKleader-Cas9site-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA ...
-
bioRxiv - Bioengineering 2021Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Neuroscience 2021Quote: ... and R-CEPIA1er (Addgene #58216) (38) ...
-
bioRxiv - Genetics 2020Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Systems Biology 2022Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Systems Biology 2023Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Cell Biology 2023Quote: ... and TALEN-R (Addgene 35432) plasmid targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Biophysics 2021Quote: ... R-GNB1 was generated by swapping R against EGFP in EGFP-GNB1 described previously (Addgene #133856) using restriction sites AgeI and BsrGI (8) ...
-
bioRxiv - Biochemistry 2024Quote: To make plasmid-based R-loops 2µg of pUC19-Mu-switch-R-loop plasmid (Addgene: 134899) was incubated in a final reaction volume of 200µl containing 1x T7 polymerase reaction buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Cre-containing plasmid was obtained from Addgene (pLM-CMV-R-Cre, Addgene #27546). A fragment encoding the CMV promoter and mCherry-T2A-Cre-WPRE was excised by NdeI and SacII (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... pUC-DEST-R3R4(R) (Addgene #141010) the Gateway LR Clonase II Enzyme Mix.
-
bioRxiv - Cell Biology 2020Quote: ... pCMV-R-GECO1 (Addgene Plasmid #32444), pCMV-mCherry-CD9 (Addgene Plasmid #55013) ...
-
bioRxiv - Cell Biology 2021Quote: ... pUC-DEST-R3R4(R) (Addgene #141010) and the Gateway LR Clonase II Enzyme Mix (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... and TALEN-R (Addgene no. 35432) plasmid ...
-
bioRxiv - Genomics 2024Quote: ... and TALEN-R (Addgene no. 35432) plasmids were introduced to K562 cells via electroporation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and TALEN-R (Addgene no. 35432) plasmid using program T-016 on the Nucleofector 2b (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... Ub-R-EGFP under CUP1 promoter was cloned from the plasmid pYES2-Ub-R-EGFP (Addgene #11953) (29 ...
-
bioRxiv - Genetics 2020Quote: The primers ABEmax-F/ABEmax-R and AncBE4max-F/ AncBE4max-R was used to amplified pCMV_ABEmax_P2A_GFP (Addgene #112101) and pCMV_AncBE4max (Addgene #112094 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Gentamicin-R and Kanamycin-R) were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677 ...
-
bioRxiv - Biochemistry 2024Quote: The expression plasmid for R-GECO1 (CMV-R-GECO1) was a gift from Robert Campbell (Addgene plasmid #32444) (38) ...
-
bioRxiv - Neuroscience 2022Quote: ... pTorPE-R-GECO1 (62) (Addgene Plasmid # 32465) was a gift from Robert Campbell (University of Alberta) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and AAVS1 TALEN-R (Addgene plasmid #59026) 84 were used for targeting the UBrtTA ...
-
bioRxiv - Biochemistry 2023Quote: ... Plasmid pCMV-R-GECO1 (Addgene Plasmid # 32444) was a gift from Robert E ...
-
bioRxiv - Cell Biology 2021Quote: ... the sequence coding for R-GECO1 including TorA-tag from pTorPE-R-GECO1 (a gift from Robert Campbell (Addgene plasmid #32465 ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting TGTCCCCTCCACCCCACA and AAVS1-TALEN-R (Addgene #35432) targeting TTTCTGTCACCAATCCTG) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9.syn.flex.GcaMP6s (Addgene, Catalog# pNM V3872TI-R(7.5)) ...
-
bioRxiv - Genetics 2023Quote: ... and 1.5 µg AAVS1 TALEN R (Addgene 59026) using Lipofectamine 3000 Transfection Reagent (Invitrogen L3000015 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9.syn.flex.GcaMP6s (Addgene, Catalog# pNM V3872TI-R(7.5)) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-syn.flex.GcaMP6s (Addgene, Catalog# pNM V3872TI-R(7.5)) ...
-
bioRxiv - Developmental Biology 2020Quote: ... gRNA oligos for WNT11 (F: CACCGGTCCTCGCTCCTGCGTGGGG; R: AAACCCCCACGCAGGAGCGAGGACC) and PAX2 (F: CACCGATGACCGCCACTAGTTACCG; R: AAACCGGTAACTAGTGGCGGTCATC) were synthesized and cloned into the lentiCRISPR v2 plasmid (Addgene # 52961). First ...
-
bioRxiv - Cell Biology 2021Quote: ... and cytosolic Ca2+ was monitored by the intensity of the sensor R-GECO (plasmid was a gift from R. Campbell, Addgene #45494). To decrease cytosolic Ca2+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Cancer Biology 2021Quote: The M-CSF promoter reporter (pMCSF-R-luc Addgene plasmid # 12420 ...
-
bioRxiv - Cell Biology 2024Quote: ... pCMV R-Cepia3mt and px459 plasmids were from Addgene (#23213 ...
-
bioRxiv - Physiology 2024Quote: ... Lyn-R-GECO1 (gift from Won Do Heo (Addgene plasmid # 120410 ...
-
bioRxiv - Synthetic Biology 2020Quote: Ub-R-GFP was a gift from Nico Dantuma (Addgene plasmid # 11939 ...
-
bioRxiv - Molecular Biology 2022Quote: ... target DNA sequence was cloned into 13S-R (Addgene # 48328). For testing the CRISPR interference in vivo ...
-
bioRxiv - Developmental Biology 2022Quote: ... wnt8a/pcs2+ (XE10, from R. Moon; Addgene plasmid 16865; BamHI/T3). Antisense RNA probes labelled with digoxygenin-11-UTP (Roche ...
-
bioRxiv - Neuroscience 2022Quote: TALENs (AAVS1-TALEN-L and AAVS1-TALEN-R; Addgene, 59025/59026)(Gonzalez et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... CMV-mito-R-GECO1 was a gift from Robert Campbell (Addgene plasmid #460218 ...
-
bioRxiv - Molecular Biology 2024Quote: ... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
bioRxiv - Microbiology 2022Quote: ... Then pLNCX myr-Akt_K179M (Addgene #9906, a gift of William R. Sellers) was digested with SmaI + DraIII to release a 289 bp fragment containing the K179M mutation in the context of AKT1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Vectors used and sources: AAV9.syn.flex.GcaMP6s (Addgene, Catalog# pNM V3872TI-R(7.5)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... This construct was commercially synthesized (GeneArt) and cloned into 13S-R (Addgene # 48328) to produce pCR_Array/I-G (Table S4) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of CB1-GFP and 100 ng of R-GECO (Addgene #32444) were mixed with 0.2 µL of lipofectamine 2000 transfection reagent ...