Labshake search
Citations for Addgene :
51 - 100 of 1030 citations for Acetylcholinesterase Fluorescent Activity Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Retrograde adeno associated viruses encoding green fluorescent protein (Addgene, Catalog number 50465-AAVrg) or tdtomato (Addgene ...
-
bioRxiv - Physiology 2021Quote: ... Fluorescent protein sequences were PCR-derived from pmVenus(L68V)-mTurquiose2 (Addgene plasmid #60493), Gamillus/pcDNA3 (Addgene plasmid #124837) ...
-
bioRxiv - Systems Biology 2023Quote: ... and to amplify the fluorescent proteins from plasmids (SYFP2 from pSYFP2-C1 Addgene #22878 ...
-
bioRxiv - Cell Biology 2023Quote: (A) Dual-fluorescent reporter plasmid pFU-GW-sMYH6-mNeon-TNNT2-mScarlet (Addgene #170712). (B ...
-
bioRxiv - Cancer Biology 2024Quote: Pre-Intact clone was infected with pLV-Azurite (blue fluorescent protein, Addgene, 36086) and Pre-ARSIR1 clone was infected with SGEP-Renilla-713 (GFP ...
-
bioRxiv - Microbiology 2021Quote: ... WT Cas9 activity was checked using the XPR_047 assay (a gift from David Root, Addgene 107145) and was always >80-90% ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reporter assays to assess RUNX1 transcriptional activity were done using the pMCSF-R-luc plasmid (Addgene plasmid #12420 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CRIPSRi activity in each cell line was validated by lentiviral transduction with pCRISPRia-v2 (Addgene #84832) backbones containing either a guide RNA (gRNA ...
-
bioRxiv - Neuroscience 2019Quote: ... or GFP (pAAV-CaMKIIa-EGFP; AAV5) as a fluorescent marker (Addgene, Cambridge Massachusetts, US).
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Cell Biology 2023Quote: ... the GFP fluorescent tags of ITGB3-GFP (gift from Jonathan Jones – Addgene plasmid #26653) and GFP-Talin1 (gift from Anna Huttenlocher – Addgene plasmid #26724 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLenti-PGK-Neo-PIP-FUCCI (Fluorescent Ubiquitination-based Cell Cycle Indicator) (Addgene # 118616) was used for accurate cell cycle phase indicator [34] ...
-
bioRxiv - Neuroscience 2023Quote: ... dopamine was recorded with a red fluorescent GRABDA sensor (AddGene #140557AAV9-hSyn-GRAB rDA1h), while VTA DA terminals in the NAcc were stimulated for the approximate duration of the offer cue (500-600 ms) ...
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Immunology 2023Quote: Fluorescent reporter viruses were generated by transfection of a three-plasmid system: pMD2.G (Addgene, Watertown ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Biophysics 2019Quote: ... The enhanced activity SrtA pentamutant was expressed and purified from bacteria using the pET29-eSrtA vector (Addgene, #75144) as previously reported 31 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reporter assays to assess RUNX1 transcriptional activity were done using the pMCSF-R-luc plasmid (Addgene plasmid #12420; http://n2t.net/addgene:12420; RRID:Addgene_12420) (Zhang et al. ...
-
bioRxiv - Genetics 2020Quote: ... Cas9 activity was assessed by transducing parental Vero-E6 or Vero-E6-Cas9 cells with pXPR_047 (Addgene 107645), which expresses eGFP and an sgRNA targeting eGFP (72) ...
-
bioRxiv - Cancer Biology 2024Quote: ... DHB-mVenus (CDK2 activity reporter) was a gift from Tobias Meyer & Sabrina Spencer (Addgene plasmid # 136461; http://n2t.net/addgene:136461; RRID:Addgene_136461) (27).
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: Fluorescent TLR1, TLR2, TLR4, TLR6, and Myd88 constructs (13014, 13015, 13016, 13018,13020) were obtained from Addgene.
-
bioRxiv - Cancer Biology 2020Quote: ... A plasmid expressing Green Fluorescent Protein (GFP) (pLJM1-EGFP was a gift from David Sabatini (Addgene plasmid # 19319 ...
-
bioRxiv - Cancer Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: Projecting neurons were labeled with retrograde fluorescent tracers (Retrobeads, Lumafluor, and pAAV-CAG-tdTomato, Addgene 59462P). Fluorescent beads were stored at 4°C before use ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell lines were transiently transfected with a membrane-targeted fluorescent protein (glycosylphosphatidylinositol-anchored eGFP, Addgene #32601) using a TransIT-X2 transfection kit (Mirus) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Vectors for arabinose memory (pAra) and the GFP reporter of recombinase activity (pRec1-OFF) were obtained from Addgene (40). In pAra ...
-
bioRxiv - Neuroscience 2023Quote: ... we first labeled odor responsive neurons with the permanent activity marker FLEX-RAM (Addgene # 84468, (Sørensen et al., 2016)) in-vivo ...
-
bioRxiv - Neuroscience 2024Quote: ... A genetically encoded calcium indicator for the detection of ACh activity (1 μL, AAV9-hSyn-ACh3.0; AddGene; Watertown, MA) was infused into the medial prefrontal cortex (AP(2.7mm) ...
-
bioRxiv - Biochemistry 2021Quote: The ORAI1-yellow fluorescent protein (YFP) construct was purchased from Addgene (Cambridge, MA, USA; plasmid no. 19756). Site directed mutagenesis using the Pfu Turbo DNA polymerase from Agilent Technologies (Santa Clara ...
-
bioRxiv - Neuroscience 2021Quote: ... retrograde AAV expressing enhanced blue fluorescent protein (EBFP) and Cre recombinase (AAVrg-pmSyn1-EBFP-cre, Addgene #51507) was injected into either NAc or RSC of Rosa26TdTomatoAi9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human melanoma cell lines with fluorescent BRN2 reporter were further transduced with pHIV-Luc-ZsGreen (Addgene 39196) and selected with neomycin (800 μg/mL ...
-
bioRxiv - Neuroscience 2023Quote: Viral vectors encoding the fluorescent dopamine indicator dLight1.2 (AAV5-hSyn-dLight1.2) (Addgene, titer ≥ 4×10¹² vg/mL) and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the lentiviral vector pdCAS9-humanized (code 44246) with an engineered mCherry fluorescent signal was acquired from Addgene and transduced into K562 cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cas9 expression was confirmed by immunoblot analysis and Cas9 activity was confirmed using a Cas9 GFP reporter [(pXPR_011 (Addgene #59702)] that showed near maximal editing 10 days after infection ...
-
bioRxiv - Cell Biology 2022Quote: Three different dCas9 fusion proteins were tested for dCas9 activity in both K562 and hiPSC lines: pLX_311-KRAB-dCas9 (Addgene 96918), pB-CAGGS-dCas9-KRAB-MeCP2 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... In vitro target specific gRNA cleavage activity was validated by transfecting N2A cells with PCR amplified gRNA gblock and Cas9 plasmid DNA (px330, Addgene) using ROCHE Xtremegene HP ...
-
bioRxiv - Cancer Biology 2023Quote: Autophagy degradative activity (autophagic flux) was measured using an expression vector encoding the fusion protein mCherry-EGFP-LC3B (Addgene, #22418). We transfected JHU 011 cell line with pBabe-mCherry-EGFP-LC3B vector and established a stable cell line by puromycin selection ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Cell Biology 2022Quote: ... mRFP-GFP tandem fluorescent-tagged LC3 (tfLC3) was a gift from Tamotsu Yoshimori (Addgene plasmid # 21074; www.addgene.org/21074)51 ...
-
bioRxiv - Microbiology 2022Quote: ... 1µg of lentiviral vector bearing green fluorescent protein (GFP) (PLV-eGFP) (gift from Pantelis Tsoulfas, Addgene plasmid # 36083) 90 using Jetprime transfection reagent (Polyplus ...