Labshake search
Citations for Addgene :
51 - 100 of 1551 citations for 6 Methyl 4H pyrido3 2 b1 4oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... One copy of mKate2 (Addgene #68441) was fused to a strong promoter from the Anderson collection (Table 2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Neuroscience 2023Quote: Trh-Cre mice of age 2-3 months were injected with AAV1-hSyn-Flex-GCaMP6s (Addgene, 100845). More than 3 weeks after surgery ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and one ug pMD2.G (Addgene #12259) into a 10-cm dish of 293FT cells (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Systems Biology 2019Quote: ... 350k HAP1 WT cells were seeded into a 6-well plate and 24 hours later cells were transfected with a mix of 2 µg pX459 plasmid (Addgene #62988) carrying a gRNA ...
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Genomics 2022Quote: ... Two gRNAs (one targeting row and one targeting the white gene) was cloned into pCFD4d plasmid (Addgene plasmid #83954) (as described in the protocol “cloning two gRNAs into plasmid pCFD4” ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were seeded at 80% density in a 10-cm tissue cell culture treated dish and transfected with the 6 µg of expression plasmid and packaging plasmids 2 µg of pMD2.G (Addgene, cat# 12259) and 4 µg of psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... 2017 #6} (Addgene, Cat#1000000115), and verified by PCR ...
-
bioRxiv - Physiology 2023Quote: ... 6 μg of psPAX2 (Addgene), and 15 μg of pLV6-BMAL1-Luc vector (Addgene) ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid for tagging the N-terminus of the human lamin B1 gene (LMNB1) with RFP was purchased from Addgene (LMNB1-mTagRFP-T, #114403). The plasmid sequence was validated by Sanger sequencing.
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Cancer Biology 2024Quote: All-in-One-GFP and All-in-One-mCherry plasmids were purchased from Addgene (AIO-GFP #74119 and AIO-mCherry #74120). Their constructions have been described in (22).
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequence for L7-6 was obtained from pAAV/L7-6-GFP-WPRE (Addgene plasmid #126462) and ordered as a gBLOCK (IDT) ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319 ...
-
bioRxiv - Developmental Biology 2021Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 μg of psPAX2 (12260; Addgene), and 3 μg of pVSVg (8454 ...
-
bioRxiv - Microbiology 2022Quote: ... 6 µg PMD2.G (Addgene, 12259), 18µg PsPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 μg, Addgene plasmid # 12260) and pAdVAntage (3 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg pMD2.G (Addgene, 12259), 4 μg pUMVC (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Molecular Biology 2019Quote: The all-in-one vector pCas3cRh (Addgene number 133773) is a derivative of the pHERD30T-IC plasmid ...