Labshake search
Citations for Addgene :
351 - 400 of 1676 citations for 6 Methyl 4H pyrido3 2 b1 4oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RD cells were transfected with the all-in-one Cas9/gRNA plasmid pSpCas9 BB-2A-GFP (PX458; Addgene; gRNA target sequence ...
-
bioRxiv - Cell Biology 2021Quote: The generation of stable knockout cell lines was achieved using the LentiCRISPRv2 system (one-vector system, Addgene #52961) or LentiGuide-Puro system (two-vector system ...
-
bioRxiv - Neuroscience 2022Quote: ... and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer: 5.9×1012 GC/mL, Addgene #126941). PV mice (n=9 ...
-
bioRxiv - Plant Biology 2023Quote: ... in a one-step restriction-ligation reactions with a double CaMV35s-ΩTMV promoter/5′ UTR (pICH51288; Addgene #50269), a C-terminal GR tag (pEPOZ0CM0137 ...
-
bioRxiv - Cancer Biology 2023Quote: The one-step multiplex CRISPR-Cas9 assembly system kit was a gift from Takashi Yamamoto (Addgene Kit #1000000055) (2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TC-71 were transduced with lentiviral Tet-pLKO- puro all-in-one vector system (plasmid #21915, Addgene) containing a puromycin-resistance cassette ...
-
bioRxiv - Molecular Biology 2024Quote: ... One day after seeding 2000 ng universal donor (pCRISPaint- myc-PuroR, Addgene plasmid # 80961; pCRISPaint- TagGFP2-PuroR, Addgene plasmid # 80970 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the ER localization marker mCherry-ER-3 (Addgene: 55041) for 2 days ...
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082 ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg D8.9 and 3 µg pCMV-VSV-G (Addgene) packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and (3) mKok amplified from pCS2+ ChMermaid S188 (Addgene 53617) with the CAAX membrane tag sequence (Sutcliffe et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: pHA#852: mec-4p∷FynY531F∷unc-54 3’UTR (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Genetics 2024Quote: ... gfp and unc-54 3’UTR from pPD95.75 (Addgene #1494) using primers P29 and P30 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or shRNAs against YAP (5’-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC -3’, cat. 27368, Addgene, pLKO1-shYAP1 was a gift from Kunliang Guan ...
-
bioRxiv - Cell Biology 2021Quote: ... or into ‘All-in-one-GFP’ plasmid (AIO-GFP, gift from Steve Jackson (Addgene plasmid # 74119 http://n2t.net/addgene:74119; RRID: Addgene_74119))69 ...
-
bioRxiv - Cell Biology 2021Quote: ... Each guide RNA pair was cloned into either the ‘All-in-one-mCherry’ plasmid (AIO-mCherry, gift from Steve Jackson (Addgene plasmid # 74120; http://n2t.net/addgene:74120; RRID: Addgene_74120)) or into ‘All-in-one-GFP’ plasmid (AIO-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... anesthetized GAD1:Cre rats and wildtype littermates were injected with one of three AAV2 viral constructs obtained from Addgene: hSyn-DIO-hM4D(Gi)-mCherry ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNMT3B shRNAs were cloned into Tet-ON all- in-one plasmids LT3GEPIR (gift from Johannes Zuber, Addgene Plasmid #111177, RRID:Addgene_111177) and LT3REPIR (same as LT3GEPIR except for GFP being substituted with dsRed ...
-
bioRxiv - Cancer Biology 2019Quote: ... RDES and TC-32 were transduced with lentiviral pLKO-TET-ON all-in-one vector system (Plasmid #21915, Addgene) containing a puromycin resistance cassette ...
-
bioRxiv - Cancer Biology 2024Quote: ... and MHH-ES-1 were transduced with lentiviral Tet-pLKO-puro all-in-one vector system (plasmid #21915, Addgene) containing a puromycin-resistance cassette ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6 mice were injected with the AAV5-CAG-ChR2-mCherry adenovirus (200 nL, Addgene) in the PC ...
-
bioRxiv - Neuroscience 2021Quote: ... MEFs were then expanded to 6-well plates and transiently transfected with SV40T antigen (Addgene) and maintained until stably proliferative ...
-
bioRxiv - Neuroscience 2022Quote: [6] 15xQUAS from BAC-ECFP-15xQUAS_TATA-SV40 (a gift from Christopher Potter, Addgene ID #104875) (Riabinina et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-week-old Slc17a7Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid encoding 2×FKBP-GFP-Rab29 was generated by transferring 2×FKBP sequence from Addgene plasmid #20149 into Hind III site of pCMV10 plasmid followed by inserting EGFP-Rab29 sequence into Not I - Xho I site of pCMV10 ...
-
bioRxiv - Cell Biology 2022Quote: ... pcDNA3.1-SARS2-Spike (2) and pcDNA3.1-hACE2 (2) were obtained from Addgene (Addgene plasmids #145032; #145033); pCI-SARS2-Spike expressing a codon optimized version of the gene coding for S protein of SARS-CoV-2 was provided by Nicolas Escriou (Institut Pasteur) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Molecular Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Neuroscience 2019Quote: ... into pPD132.102 (pmyo-2, #1662, Addgene) via restriction with BamHI and EcoRI ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2) pEVOL-pBpF (Addgene #31190), which encodes a tRNA synthetase/tRNA pair for the in vivo incorporation p-benzoyl-l-phenylalanine (BPA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pCMV-VSVG (Addgene 8454), 2 μg pMDLg/pRRE (Addgene 12251) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or lentiCRISPRv.2-hygro (Addgene 98291). Validation of guide specificity was assessed by Western blot of low-passage cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pMDLg/pRRE (Addgene 12251), 2 μg pRSV-Rev (Addgene 12253) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pRSV-Rev (Addgene 12253), and 2 μg lentiviral plasmid carrying transgene (LeGO iG-CDK4R24C ...
-
bioRxiv - Immunology 2021Quote: ... 2 µg PMD2G plasmids (12259, Addgene), 40 µL of P3000 Reagent (Thermo Fisher Scientific) ...