Labshake search
Citations for Addgene :
901 - 950 of 1790 citations for Mono 2 Ethyl 5 Carboxypentyl Phthalate 90% Pure 13C4 99% Dehp Metabolite V ;100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... or AAV5-hDlx-GqDREADD-dTomato (3.15×10^15 virus molecules/mL) (Addgene plasmid # 83897 ...
-
bioRxiv - Cell Biology 2021Quote: HyPer7 (pCS2+MLS-HyPer7, a gift from Vsevolod Belousov, Addgene plasmid #136470)) is an ultrasensitive fluorescent ratiometric probe for detection of mitochondrial H2O2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 26 or AAV5-hSyn-DIO-mCherry (2.3 × 10^13 GC/ml; Addgene) was bilaterally injected into either the mPFC (AP:1.7 ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5μl pGP-AAVrg-syn-jGCaMP7f-WPRE virus 25 (1.85× 1013GC/ml; Addgene) was infused into the NAc (A/P ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-EF1a-fDIO-mCherry (1 × 1013 vg/ml, 100nl unilateral, #121675, Addgene), AAVrg-EF1a-DIO-FLPo-WPRE-hGHpA (titer 1.6 × 1013 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVrg-Ef1a-fDIO-mCherry (2.2 × 1013 vg/ml, 100nl unilateral, #114471, Addgene), AAV9-EF1a-fDIO-Cre (1.3 × 1013 vg/ml ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-DIO-NES-jRcamp1b-WPRE-SV40 (Addgene, 4.5E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: ... two 200 nL injections of AAV.CAG.Flex.GCaMP6s.WPRE.SV40 (1.9 x 1013 GC/ml, Addgene), were performed in the LC of C57BL/6-Tg(Dbh-icre)1Gsc mice (Jax 4355551 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV-hSyn1-SIO-stGtACR2-FusionRed (1×1013 GC/mL, Addgene,105677-AAV1), AAV-synP-DIO-EGFP-WPRE-hGH (0.9×1013 GC/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... flp-dependent mCherry (2E13 GC/mL, AAV9-Ef1a-fDIO-mCherry, Addgene 114471) was injected at two sites in the AC (1.3 and 1.7 mm anterior to lambdoid suture at the temporal ridge ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2/-Syn-ChrimsonR-tdT43 (Addgene plasmid 59171, 1.3×1013 GC ml-1). Dual opsin-assisted circuit mapping and opto-tagging in brain slices ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVrg-hSyn-DIO-EGFP (1.8 × 1013 vg/ml, 100nl unilateral, #50457, Addgene), AAVrg-Ef1a-fDIO-mCherry (2.2 × 1013 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-fDIO-Cre (1.3 × 1013 vg/ml, 100nl unilateral, #121675, Addgene), AAV5-EF1a-fDIO-mCherry (1 × 1013 vg/ml ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV2 hSyn-DIO-mCherry (1.8 × 1013 vg/ml, Addgene, #50459-AAV2). For slice electrophysiology ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hSyn-hM4D(Gi)-mCherry (8.6 x 1012 vg/mL, Addgene #50475), and AAV5-hSyn-hM3D(Gq)-mCherry (1.9 x 1013 vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV-pCAG-FLEX-EGFP-WPRE (Addgene, 51502-AAV1, 1.9×1013 vg/mL), and pAAV-hSyn-EGFP (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg-hSyn-mCherry (2.0x1013 vg/mL; 114472-AAVrg; Addgene, Watertown, MA) as a vector control ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-Syn-Flex-GCaMP6m-WPRE-SV40 (1×10¹³ vg/ml, Addgene 100838).
-
bioRxiv - Immunology 2023Quote: ... 700 ng/mL of Protein A/G-MNase (plasmid Addgene ID:123461) were added to the immunocomplexes ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 CaMK2a-stGtACR2-FusionRed (1.3 × 1013 gp/mL) (Addgene #105669)83
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 8 hSyn-DIO-mCherry (2.2 × 1013 gp/mL) (Addgene #50459)
-
bioRxiv - Neuroscience 2024Quote: ... rAAV5-hsyn-mCherry-WPRE (Addgene #114472, Titer: 8 x 1012 GC/mL) was injected unilaterally (60-100 nL at 40 nL/min ...
-
bioRxiv - Neuroscience 2024Quote: - AAV8 hSyn-DIO-hM3D(Gq)-mCherry (2.1 × 1013 gp/ml) (Addgene #44361)
-
bioRxiv - Neuroscience 2024Quote: ... or AAVrg-hSyn-hM4D(Gi)-mCherry (Addgene, #50475-AAVrg, 2.4×1013GC/ml) were then injected intraspinally with a glass capillary 40 ...
-
bioRxiv - Neuroscience 2024Quote: We used AAVrg-Cre (Addgene 55636-AAVrg, titer; 2.2 x1013 pfu/ml), AAVrg-FLEX-GFP (Addgene 51502-AAVrg ...
-
bioRxiv - Developmental Biology 2020Quote: The zebrafish gfap promoter 51 was derived from the Addgene plasmid: pEGFP-gfap(Intron1/5’/Exon1-zebrafish) (Addgene, #39761) and lssmKate2 65 was derived from the Addgene plasmid ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Bioengineering 2022Quote: ... and LT1 (305 μL) was combined with a DNA mixture of the packaging plasmid pCMV_VSVG (Addgene 8454, 5 μg), psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... and 5 mg sgRNA cloned into the BsmBI restriction site of the MLM3636 plasmid (gift from Keith Joung, Addgene plasmid #43860 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Cell Biology 2019Quote: ... All gRNA plasmids were generated with primers listed in Supplementary Table 5 (IDT) and integrated into pX330 (Addgene #42230) vector using Zhang Lab General Cloning Protocol 29 ...
-
bioRxiv - Cell Biology 2019Quote: ... and Firefly Luciferase (5’-TGAAGTCTCTGATTAAGTA-3’) were cloned into the HpaI and XhoI restriction sites in pSICOR (Addgene RRID:Addgene_11579) (Ventura et al. ...
-
bioRxiv - Genetics 2019Quote: ... Vector pZZ113 containing sgRNA expression cassette against cbr-dpy-5 was derived from PU6∷unc-119_sgRNA (Addgene plasmid # 46169) as described (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: Four mice (experimental group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-ChR2-WPRE-eYFP (Addgene viral prep 20298-AAV5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... This middle entry vector was Gateway recombined using a 5’ entry zebrafish ubiquitious promoter (Addgene #2732, Watertown, MA, USA), a 3’ entry pA vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CasX2 ORF was amplified from pBLO 62.5 (pBLO 62.5 was a gift from Jennifer Doudna and Benjamin Oakes, Addgene plasmid #123124; http://n2t.net/addgene:123124; RRID:Addgene 123124) [39] ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Neuroscience 2023Quote: ... Cre-expressing BNST neurons were induced to express eYFP (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; Addgene_27056) for visualization of BNST AVP neurons.
-
bioRxiv - Genetics 2023Quote: ... a pDestTol2CG2-eye-bfp with the independent marker beta-crystaline:BFP a kdrl P-5’entry clone (Addgene, Santoro Lab), an EGFP-CAAX p-middle entry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... The top 5 crRNA spacer sequences were selected and cloned into the pX459v2 Cas9 Puro Plasmid (Addgene Plasmid #62988) using single-step golden-gate cloning ...
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...