Labshake search
Citations for Addgene :
751 - 800 of 1790 citations for Mono 2 Ethyl 5 Carboxypentyl Phthalate 90% Pure 13C4 99% Dehp Metabolite V ;100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and AAV9-CaMKIIa-EGFP (titer: 1×10¹³ vg/mL, Addgene) for chemogenetic silencing and viral control ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, 44362, vg/mL) or pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-jGCamp7s (Addgene 104491, titer; 2.5 x1013 pfu/ml). AvilCreERT2 mice received a total volume of 20 ul of viral injection into the medial and left lobes of the livers ...
-
bioRxiv - Neuroscience 2024Quote: - AAV8 hSyn-DIO -mCherry (2.3 × 1013 gp/ml) (Addgene #50459)
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Systems Biology 2022Quote: ... we first prepare the vector backbone by incubating 5 ug of PB-TRE-dCas9-VPR (Addgene #63800) for 2 h at 37°C with 2 ul of FastDigest FspAI (ThermoFisher cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... mNT-sgRNA-R: 5’-AAACCGCGGAGCCGAATACCTCGC-3’) were cloned into the lenti-sgRNA(MS2)-zeomycin backbone (Addgene #61427) using BsmBI ...
-
bioRxiv - Neuroscience 2019Quote: Mice 5-7 weeks old received bilateral microinfusion of AAV1-CamKiia-hChR2(H134R)-mCherry.WPRE.hGH (Addgene, #26975-AAV1) layer 2/3 of the barrel cortex (−1.3mmAP ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were transduced with floxed jGCaMP7b (AAV1-syn-FLEX-jGCaMP7b-WPRE; Addgene #104493, MOI = 5×105 vg) [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2022Quote: ... Circuit-specific viral expression was achieved using the retrograde properties of adeno-associated virus (AAV) serotype 5 23: AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540). Sparse labelling was obtained using Cre-inducible ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860; http://n2t.net/addgene:55860; RRID:Addgene_55860). Matrix-roGFP (mt-roGFP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the first 639 bp of the 5’ end of p65HSF1 from pAC1393-pmax-NLSPUFa_p65HSF1 (Addgene, #71897). These were then Gibson assembled along with an IDT gBlock containing the last 300 bp of p65HSF1 that had been codon optimised for expression level detection distinct from endogenous mRNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have cloned their respective oligonucleotides in following vectors: PDX1 in pX330A-1×5 (Plasmid #58769, Addgene), NKX6.1 in pX330S-2 (Plasmid #58778 ...
-
bioRxiv - Genetics 2023Quote: ... the FKBP coding sequence was amplified from the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... and the sgRNA cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmids were named pGGG-ZIP4-B2 Construct 1 (containing sgRNA 4 and 12 ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Neuroscience 2023Quote: ... RRID:Addgene_20297) or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Systems Biology 2024Quote: We established a stable Cas9-expressing line by infecting EpiSC-5 cells with lentiCas9- Blast (Addgene 52962), followed by selection with 5 µg/ml blasticidin (Sigma 15205 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5.CaMKII.tdTomato (Neurophotonics, 661-aav5) was used to label excitatory neurons and AAV9.CaMKII.GCaMP6s.WPRE.SV40 (Addgene, 107790) was employed to image excitatory neuronal calcium activity ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 μg of pSpCas9(BB)-2A-GFP (PX458) (gift from Feng Zhang, Addgene plasmid #48138) containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...
-
bioRxiv - Biophysics 2021Quote: The plasmid with cDNA encoding SARS-Cov-2 spike HexaPro (S) was obtained from Addgene. To express the S protein ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G, Addgene #12259) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HN30 and HN31 cell lines were transfected with 2 μg mCherry (Addgene, Plasmid 41583) as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... we used an existing CMV-driven SARS-CoV-2 plasmid (pcDNA3.1-SARS2-Spike, Addgene 145032)(Shang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Cell Biology 2019Quote: ... the guide RNA sequence (Supplemental Item 2) was cloned into the PX330 plasmid (Addgene #42230), which expresses S ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Microbiology 2021Quote: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Microbiology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (a gift from Nevan Krogan, Addgene plasmid # 141382) was used to express S-protein from the original SARS-CoV-2 strain (WT) ...
-
bioRxiv - Molecular Biology 2023Quote: 2 µg total of multiplex sgRNA vector and EF1α-dCas9-VPR-Puro vector (Addgene #99373) at a 2:1 molar ratio were mixed with 5 µl of Lipofectamine 2000 (Thermo ...
-
bioRxiv - Biophysics 2022Quote: SARS-CoV-2 S HexaPro plasmid was a gift from Jason McLellan (Addgene plasmid # 154754). This plasmid contains CMF promotor driven expression of the SARS-COV-2 Spike-B.1 ectodomain (1-1208 AAs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Genomics 2023Quote: ... guide pair 2: TTGCGGCGCTGTGGCGCCGA and CGCTCCCGCAAGTGGATGTC) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described [49] ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected organoids for 2 weeks with the AAV1-hSYN-eGFP virus (Addgene, 105539-AAV1), which directs expression of eGFP under the neuron-specific synapsin promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were co-transfected with enveloping (pCMV14-3X-Flag-SARS-CoV-2 S (Addgene #145780) for PVs or pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... pEvol-pAzFRS.2.t1 was a gift from Farren Isaacs [Amiram et al 2017] (Addgene plasmid # 73546 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA sequences (Extended Data Table 2) were inserted into the pDD162 vector (Addgene #47549) by linearizing the vector with 15 base pairs (bp ...