Labshake search
Citations for Addgene :
901 - 950 of 1132 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... We next used the human EZH2 primary protein sequence available in the addgene for hEZH2 plasmid (#24230, Addgene) and predicted the possible cysteine residues using the GPS-SNO prediction tools ...
-
bioRxiv - Cell Biology 2024Quote: ... For G3BP1 live imaging a GFP-G3BP1 fusion protein containing plasmid (pEGFP-C1-G3BP1-WT, Addgene plasmid # 135997) was transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The SNAP protein was amplified from the DNA-CARzeta-GFP plasmid (a gift from Ron Vale, Addgene # 89344). The monomeric streptavidin (mSA) ...
-
bioRxiv - Neuroscience 2023Quote: ... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA). Virus (0.5 µl ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757; http://n2t.net/addgene:70757; RRID:Addgene_70757) (69) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pcDNA3-YFP (for YFP protein) was a gift from Doug Golenbock (Addgene plasmid #13033; http://n2t.net/addgene:13033; RRID:Addgene_13033). Plasmid pcDNA3-YFP-APE1 (for WT YFP-APE1 protein ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ; http://n2t.net/addgene:167585 ; RRID:Addgene_167585).
-
bioRxiv - Cell Biology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486; http://n2t.net/addgene:72486;RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Neuroscience 2023Quote: ... were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008, Addgene) used as a backbone after excising axonGCaMP6s by BamHΙ and NheΙ ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of the chimeric protein unc84:2xGFP17 was isolated from the original pMUH_unc84_2XGFP plasmid (Addgene #46023) via PCR using the following primers (5’-AACAGATCTGCGGCGGCAAAATGGCTCCCGCAACGGAAG-3’ and 5’-CGGCCCCTAGGGCGGTCACACCACAGAAGTAAGG-3’) ...
-
bioRxiv - Biochemistry 2024Quote: ... His6-tagged proteins were cleaved with TEV protease (expressed and purified in-house from plasmid pRK793 (Addgene #8827)) 29 then passed over a HisTrap HP column (Cytiva ...
-
bioRxiv - Genetics 2021Quote: ... Cas9 and dCas-VP64 Calu-3 knock-in lines were then transduced with Brunello and Calabrese Set A libraries (Addgene #73179 and #92379) as appropriate ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... containing 40bp of the 5’ end of cobK to a second 923-bp PCR-generated fragment (FR2) containing 107bp of the 3’ end of cobK in a three-way ligation reaction with p2NIL backbone (Addgene plasmid #20188; (46)) ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... DREADD+ group) was bilaterally injected in the dDG with pAAV5-CaMKIIa-hM4D(Gi)-mCherry (virus titer ≥ 3×1012 vg/ml, Addgene, North Carolina, USA). Inhibitory DREADDs are activated by the artificial ligand clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2024Quote: ... and 80-100nl of either AAV5-hSyn-hChR2(H134R)-EYFP (UNC Vector core) or pAAV9-mDlx-ChR2-mCherry-Fishell-3 (Addgene viral prep # 83898) was injected into the right GPi or SNr ...
-
bioRxiv - Genetics 2024Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722, originally from 29). Library1 ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified and inserted by In-Fusion cloning between myo-2 promoter driving mCherry and unc-54 3’UTR of pCFJ90 (Addgene #19327; Watertown, MA) to generate plasmid pKM3 ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.6-0.8 uL of a 1:1 mixture of GAD1-cre and mCherry virus (AAV8-hSyn-DIO-mCherry, ≥ 1×101 3 vg/mL; Addgene, Watertown, MA, USA) was injected bilaterally into VP ...
-
bioRxiv - Cell Biology 2024Quote: Suitable gRNA target sites (5 ′ gRNA: GGAGGCTCTCGTGCCGGCTC, 3 ′ gRNA: GCTATAGGAAGCCACCGTTA) were identified by CRISPR optimal target finder 45 and cloned into pCFD5 (Addgene plasmid #73914; 46) via Gibson assembly (NEB).
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Neuroscience 2022Quote: ... A pulled glass pipette attached to a 10μl Hamilton syringe was backfilled with a solution containing a viral construct carrying gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, titer 3×1013 gc/mL Addgene cat no 104488-AAV1). To reach the appropriate titer ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Bioengineering 2024Quote: ... Double-cysteine substitution variants of DoubleCatcher were derived from pDEST14-SpyCatcher003-(GSG)3-SpyCatcher003-TEVs-SpyTag003DA by Gibson assembly: DoubleCatcher α-Lock (GenBank and Addgene deposition in progress), DoubleCatcher β-Lock (GenBank and Addgene deposition in progress) ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 3 target sequences in the human TFE3 gene (GGCGATTCAACATTAACGACAGG, GCGACGCTCAACTTTGGAGAGGG, TCGCCTGCGACGCTCAACTTTGG) and cloned these into the lentiCRISPR v2 vector (Addgene #52961, Watertown, MA, USA). Lentivirus was produced as previously described 1 and HK-2/SFPQ-TFE3 cells were infected for 48 h ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...
-
bioRxiv - Immunology 2021Quote: ... and a plasmid encoding the spike protein (with a C-terminal truncation) from either SARS-CoV (Addgene cat 170447), SARS-CoV-2 53 ...
-
bioRxiv - Biochemistry 2020Quote: The cDNAs for protein expression in this study were as follows: DCLK1 (Transomic, BC133685) and Lambda phosphatase (Addgene, 79748). DCLK1 proteins were cloned in frame using Gibson cloning into a pET28 vector with an N-terminal strepII-Tag and a superfolder GFP (sfGFP ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Microbiology 2021Quote: ... vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38 ...
-
bioRxiv - Immunology 2022Quote: A lentivirus expressing the ASC-GFP fusion protein was prepared by transfection of pLEX-MCS-ASC-GFP (Addgene 73957), psPAX2 ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a plasmid containing cloned wild type AlkB protein (pET24a-AlkB deltaN11 [plasmid #73622]) was obtained from Addgene (http://www.addgene.org/), and the AlkB protein was expressed and purified at the CSU Biochemistry and Molecular Biology Protein Expression and Purification Facility.
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Microbiology 2021Quote: ... GFP-LMP2 and mStrawberry-Ub fusion proteins were constructed by transfecting hBMECs with pBABEpuro LC3-GFP vector (Addgene, 22405), pMRX-IRES-GFP-LMP2 (GFP-LMP2 was subcloned from pCND3-GFP-LMP2 ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Synthetic Biology 2023Quote: ... that have reached ~80-90% confluency with the second generation pHR plasmid carrying the desired transgene (Supplementary Table S2) and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Immunology 2023Quote: CTLs were transiently transfected with the pEGFP plasmid encoding the EB1-GFP fusion protein (Addgene #17234, Watertown, Massachusetts, USA). Briefly ...
-
bioRxiv - Immunology 2023Quote: Fusion protein expression cassettes were cloned into the lentiviral expression vector LeGO-G2 (kind gift from Boris Fehse, Addgene plasmid #251917 ...