Labshake search
Citations for Addgene :
751 - 800 of 1132 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Immunology 2020Quote: ... Coding sequences of human full-length TREM2 (NM_018965.3) and the Δe2 isoform were synthesized and cloned into the doxycycline-inducible lentiviral pCW57-MCS1-2A-MCS2 vector (Addgene, #71782). For “add-back” experiments ...
-
bioRxiv - Microbiology 2021Quote: An sgRNA (5’-ATCACAACGATCTGTTCGTC-3’) targeting the LGMN gene was cloned into the PX459 plasmid (Addgene plasmid #62988 from Feng Zheng51) encoding Cas9 and puromycin resistance ...
-
bioRxiv - Cell Biology 2021Quote: ... the 5’ homology arm (540 bp) and 3’ homology arm (542 bp) were cloned respectively into pENTR2-L3-SfoI-Venus-PBL-R1 (Addgene #141019) and pDONR-P2rP4 (Addgene #141015 ...
-
bioRxiv - Immunology 2022Quote: The CRISPR target site for murine p53 (single guide (sg) RNA: 5’-CTGAGCCAGGAGACATTTTC-3’) was already cloned into a px330 plasmid (px330-U6-Chimeric_BB-CBh-hSpCas9, Addgene plasmid #42230) and for human p53 (sgRNA ...
-
bioRxiv - Immunology 2022Quote: ... and for human p53 (sgRNA: 5’-GCATCTTATCCGAGTGGA-3’) was already cloned into a px459 plasmid (pSpCas9(BB)-2A-Puro (px459) V2.0 (Addgene plasmid #62988)) and kindly provided by Daniel Hinze from the lab of Michael Hölzel ...
-
bioRxiv - Genetics 2022Quote: ... Enhancer reporters were produced by fusing via PCR stitching these constructs to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from the POPTOP plasmid [53] (Addgene #34848). The enhancer reporters were purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... GCAAGATGATCCCAATGAGT) or Ifngr2-targeting sgRNAs (3’-gRNA-‘5: AGGGAACCTCACTTCCAAGT) were cloned into target vector px458-pSpCas9(BB)-2A-GFP (Addgene #48138) or px459-pSpCas9(BB)-2A-Puro (Addgene #62988) ...
-
bioRxiv - Cell Biology 2022Quote: ... The guide with the highest ranking in both scoring programs (5’-CGGCGCAACAGGTCGCGAACGGG-3’) was selected for cloning into the PX459 vector (Addgene, #62988), a non-lentiviral construct that also delivers Cas9.74 Oligos containing the gRNA sequences (5’-CACCGCGGCGCAACAGGTCGCGAAC-3’ and 5’-AAACGTTCGCGACCTGTTGCGCCGC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... sgRNAs targeting the endogenous Rosa26 locus or 3’ end sequence of the Wapl gene were cloned by annealing pairs of oligos into pX330 (Addgene, #42230) to construct the pX330_Rosa26 and pX330_Wapl-mAID ...
-
bioRxiv - Developmental Biology 2021Quote: ... Human TBX5 (Horizon Discovery OHS5894-202500411) was gateway sub-cloned from its entry vector pENTR223 into the expression vector pCSf107mT-Gateway-3’myc (Addgene 67617) using clonase (ThermoFisher 11791020 ...
-
bioRxiv - Microbiology 2021Quote: ... Two single gRNA vectors containing either the 5’ or 3’ UTR-targeting gRNA were then generated using the pSAG1::Cas9-U6::sgUPRT plasmid as a backbone (Addgene #54467)5 ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Neuroscience 2020Quote: ... was generated by subcloning the 5’ (7833 bp) and 3’ (1921 bp) genomic sequences from the Ir75a-Gal4 transgene22 to flank CD4:tdGFP in pDESTHemmarG (Addgene 31221)86 ...
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCTCGTTCAGCACGGCCTCCA and reverse 5’- aaacTGGAGGCCGTGCTGAACGAGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987). To knock in eGFP into either the MFF or FIS1 loci ...
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCATTTAAATACAGTAAATAC and reverse 5’- aaacGTATTTACTGTATTTAAATGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987)10.
-
bioRxiv - Genomics 2021Quote: ... a primer binding site and restriction sites for SgsI and SdaI into the Bsp1704I site at the 3’ end of the GFP coding region of pcDNA3-EGFP (Addgene #13013). The modified plasmid was cut with SgsI and SdaI (Fermentas FastDigest ...
-
bioRxiv - Genetics 2021Quote: ... Pairs of guide RNAs targeting upstream (5’) and downstream (3’) flanking sequences were designed and cloned into LentiCRISPRv2-GFP (Addgene #82416) and LentiCRISPRv2-mCherry (#99154 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Biophysics 2022Quote: An sgRNA targeting the 3’UTR of TCOF1 proximal to the stop codon was cloned into the Cas9-containing plasmid PX458 (Addgene, 48138) by golden gate cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... the guide sequence 5’- GCCCCCAGCCTCTGCGG-3’ was cloned into the vector pSpCas9(BB)-2A-eGFP (PX458 plasmid a gift from Feng Zhang, Addgene #48138). Homology directed repair templates were designed to contain 1000bp homology arms flanking the region to be edited ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA or a tandem cassette of 3 gRNAs targeting FBXL4 was cloned into AAV-U6-gRNA-CAG-mtKeima-WPRE-hGHpA (modified from Addgene, 60229) under the U6 promoter ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Systems Biology 2022Quote: ... and added undiluted to K562 cells for a final cell concentration of 3-4 x 105 cells/mL for pJT126-based effector recruitment vectors (Addgene #161926) or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Immunology 2023Quote: ... the gRNA oligonucleotides against murine mesothelin (5’- ATGTGGATGTACTCCCACGG-3’) (synthesized by Dr. Genewiz, MA, USA) were cloned into lentiCRISPRv2 hygro vector (Addgene# 98291) as previously reported55 ...
-
bioRxiv - Neuroscience 2023Quote: ... We also note that we also attempted to create an SPR-T2A-GAL4 using the pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 construct (Addgene #62957), but no founders emerged (potentially owing to lethality when these construct elements are inserted in the SPR locus) ...
-
bioRxiv - Developmental Biology 2023Quote: Two gRNAs were designed to target the exon 3 of REV1 (Supplementary Table 2) and subcloned into the PX458 plasmid (Addgene, 48138). 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza ...
-
bioRxiv - Systems Biology 2023Quote: The CRISPRi Calu-3 cell line was generated by lentiviral delivery of pMH0001 (UCOE-SFFV-dCas9-BFP-KRAB) (19) (Addgene #85969) into Calu-3 cells ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... 5’-AAACTCCACTCTCTTAGGGAATACCC-3’) were ligated into a plasmid pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (pX601, Addgene #61591) digested with BsaI (R0535 ...
-
bioRxiv - Genetics 2023Quote: ... pSL832 [phlh-3::nls::gfp lacZ] was created by amplifying nls::gfp::LacZ from pPD96.04 (a gift from Andrew Fire, Addgene plasmid # 1502) and inserting this amplicon into a pSL780 backbone (phlh-3::lifeact::mKate2) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The well was co-transfected with 250 ng of a level 3 vector containing a construct of interest and 125 ng of BxB1 expression plasmid (Addgene #51271) using JetPrime (VWR) ...
-
bioRxiv - Genomics 2023Quote: sgRNAs targeting 3 different locations in the genome were cloned into a modified version of pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955), where BFP was replaced by superfolder GFP (sfGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Cell Biology 2023Quote: ... The vector V2 CRISPR DNA Plasmid (1ug) was co-transfected in 293T cells along with 3 µg of the viral envelope PMD2 (Addgene # 12259) and 4 µg of the viral packing PsPAX (Addgene #12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEFL knock-in (5’ – GTAGCTGAAGGAACTCATGG – 3’) were designed by DESKGEN tool and subcloned into pSpCas9(BB)-2A-GFP (Addgene, 48138) with BbsI-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... NT#3-TTGGATGGGAAGTTCACCCCG) or IP3R1-targeting shRNA (ULTRA3316782- TTTCTTGATCACTTCCACCAG) were packaged as lentiviral particles using packaging (pCMV- dR8.2 dpvr, Addgene, plasmid #8455) and envelope vectors (pCMV-VSV-G ...
-
bioRxiv - Cell Biology 2023Quote: ... bound to FOXM1-chDNA1 or gRNAs (5’-GCA GGC AGA GCG TAA GCA AA-3’ and 5’-GGA CAC ACG TTT AAT CGA GT-3’) bound to FOXM1-chDNA3 was cloned into the pX335 vector (Addgene, 42335) before the gRNA scaffold ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the SINAPs plasmid from the Singer lab (Addgene #84561)44 and a tdTomato-FL2 (containing the 3’UTR of FL2) plasmid previously cloned in-house using the tdTomato-C1 vector (Addgene #54653), a human FL2 clone in pANT7_cGST (DNASU ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2023Quote: The CD34+ cells were cultured in the expansion medium for 3-days and then nucleofected with episomal reprogramming plasmids (pCXLE-hOCT3/4-shp53 (Addgene: 27077), pCXLE-hSK (Addgene 27078 ...
-
bioRxiv - Bioengineering 2023Quote: ... is based on Addgene 12150770. AAV-sgmir96-Master (Supplementary Fig. 3) is based on pAAV-U6-sgRNA-CMV-GFP (Addgene 85451)71 ...
-
bioRxiv - Genetics 2023Quote: ... The plasmids p-yMCR.EGFP and p-yDR.EGFP were co-injected with transient sources of a single guide RNA targeting exon 2 of the yellow gene (pCFD3-dU6:3-y1-sgRNA) and Cas9 (pBS-Hsp70-Cas9, a gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger - Addgene plasmid # 46294) into a w1118 stock (BDSC #3605) ...
-
bioRxiv - Microbiology 2023Quote: ... The guide RNA was designed against exon 3 of p62 and cloned into a gRNA cloning vector plasmid (Addgene No. 41824). The Cas9 enzyme encoding hCas9 plasmid was from Addgene (No ...
-
bioRxiv - Developmental Biology 2023Quote: ... Human RFX6 cDNA clone was purchased from Horizon Discovery (OHS6084-202637733) and gateway sub-cloned from its entry vector pENTR223 into the expression vector pCSf107mT-Gateway-3⍰myc (Addgene 67617) using clonase (ThermoFisher 11791020 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of diluted CaMKII.GCaMP6f (AAV1, diluted 1:3 with dPBS or AAV9, diluted 1:10 with dPBS, Addgene number: 100834) was injected in three locations throughout auditory cortex (1.5 mm from lambda ...
-
bioRxiv - Bioengineering 2023Quote: ... gBlocks were created for this sequence with a C-terminal “LPETG” Sortase recognition site and complementary 5’ and 3’ overhangs to the BamHI/HindIII double digested pCARSF63 Thioredoxin-SUMO fusion expression plasmid (Addgene #64695).89 The resulting gBlocks were ligated into pCARSF63 expression plasmids using Gibson assembly (NEB ...