Labshake search
Citations for Addgene :
901 - 950 of 2427 citations for 2 Methyl 4 piperidin 1 ylsulfonyl phenylboronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260), and pMD2G envelope plasmid (4 µg ...
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...
-
bioRxiv - Neuroscience 2023Quote: ... and after 2 weeks of expression injected AAV8-EF1a-Con-Foff 2.0-GCamp6m-WPRE into PL (Addgene 137120-AAV8). For recordings from PL-VTA neurons ...
-
bioRxiv - Molecular Biology 2024Quote: ... a synthetic guide RNA (sgRNA) targeting RAD18 exon 2 (AGACAATAGATGATTTGCTG) was cloned hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). Parental cell lines were transfected using electroporation (Neon Transfection System MPK5000 ...
-
bioRxiv - Neuroscience 2024Quote: ... the mixture of AAV2-retro-EF1a-Cre (2 × 1013 gc/mL) and AAV5-CAG-fDIO-ArchT-GFP (plasmid: Addgene #124640 ...
-
bioRxiv - Neuroscience 2024Quote: Mice were injected with AAV1-mDlx-GCaMP6f-Fishell-2 (titer: 4.43E13; developed in the lab of Gordon Fishell; purchased from Addgene: plasmid #83899 ...
-
bioRxiv - Microbiology 2024Quote: All sgRNA oligonucleotides (Supplementary Table 2) were obtained from MilliporeSigma and cloned into the pLentiGuide-Puro plasmid (Addgene, #53963) as previously described 51,52 ...
-
Mu-opioid receptor activation potentiates excitatory transmission at the habenulo-peduncular synapsebioRxiv - Neuroscience 2024Quote: ... bilateral injections (150 nl/ hemisphere) of AAV5-EF1a-DIO-ChR2:mCherry (2-2.5 x 1013 gc/ml, Addgene 20297) were made into MHb ...
-
bioRxiv - Microbiology 2022Quote: ... or pLKO.1-blast (pLKO.1-blast was a gift from Keith Mostov (Addgene plasmid #26655 ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs included: AAV2/1-hSynapsin-1-jGCaMP8 constructs (pGP-AAV-syn1-jGCaMP8f-WPRE, Addgene plasmid #162376 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 1 μl of AAV5-hSyn-DIO-mCherry (1012 particles.ml−1, Addgene, #50459-AAV5). The virus was infused at a rate of 0.2 μL.min−1 using microinjection cannula (33-gauge ...
-
bioRxiv - Molecular Biology 2020Quote: ... were diluted (1:100) and cloned into pLKO.1 TRC-Cloning vector (Addgene # 10878) that had been digested with EcoRI and AgeI ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μL of AAV9-hsyn-cre-2a-tdT (Addgene#107738, titer ∼1×10^13) was diluted with 3 μL of PBS and was injected into the subarachnoid space of one hemisphere at the level of somatosensory cortex in Mtor-floxed-5XFAD mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... ZIF-1 and GFP-nanobody::ZIF-1 sequences were amplified from pOD2046 (Addgene #89367) (Wang et al ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Neuroscience 2024Quote: ... mixed at a 1:1 ratio with AAV8-Ef1a-Con/Fon-mCherry (Addgene #137132) or pAAV8-hsyn-DIO-mCherry (Addgene #50459 ...
-
bioRxiv - Molecular Biology 2020Quote: ... residues 1-271 (Addgene #138421), and residues 1-133 (Addgene #138422 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PLKO.1 (Addgene, #10878 [34]), for expression of Cas12a gRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µg psPAX2 (Addgene, 12260), 2 µg lentiviral plasmids and 10 µl dH2O was further added with 150 µl serum free DMEM and 9 µl X-tremeGENE HP DNA Transfection Reagent (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.shNkx2-1 (Addgene Plasmid #32400) or pLKO.shScramble (Addgene Plasmid #1864 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 Lentiviral constructs (Addgene) were transfected into 293FT cells using 35μg polyethylenimine per transfection (Alfa Aesar) ...
-
bioRxiv - Cell Biology 2020Quote: pLKO.1 puro (Addgene #8453) was modified to carry:
-
bioRxiv - Cancer Biology 2023Quote: ... The pLKO.1 (Addgene #8453) lentiviral vector was digested with AgeI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1.syn.jGCaMP7s 50 (Addgene, 104487-AAV1 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... pISH-Gucy2d-1 (Addgene, #105459), pISH-V1rb1 (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-neo (Addgene, 13425) was used as the backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-110 (Addgene #213500), α-syn 96-140 (Addgene #213501) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PLKO.1 (Plasmid #8453, Addgene) backbone was used ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-95 (Addgene #213499), α-syn 1-110 (Addgene #213500) ...
-
bioRxiv - Neuroscience 2022Quote: pLKO.1-TRC (Addgene, 10878) vector was used for the knockdown of YTHDF2 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-1:PXN-EGFP (Addgene plasmid #87420 ...
-
bioRxiv - Cell Biology 2022Quote: ... pMA122 (peel-1, Addgene #34873), and co-injection markers were injected into N2 young adult worms ...
-
bioRxiv - Cancer Biology 2024Quote: pLKO.1 puro (Addgene #8453), pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Cell Biology 2024Quote: ... pLKO.1-Scrambled (Addgene #136035) 100 was modified to express H2B-mRuby3 for visual identification of transduced cells based on a nuclear fluorescence signal101 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLKO.1-TRCN0000020840 (shSTAT3, Addgene), pLKO-TRCN0000280021 (shSTAT1 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Neuroscience 2024Quote: ... For optogentic activation of the glutamatergic PPN in Figure 3S: AAV5-Ef1a-DIO-hChR2-(E123T/T159C)-eYFP-WPRE was injected into the PPN (Addgene, 35509-AAV5, 4×10e12). For chemogenetic experiments in Figure 4 and 4S ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... donor vector (400 ng µl-1) and pHsp70-Cas9 (400 ng µl-1) (Addgene #45945) [69] ...
-
bioRxiv - Neuroscience 2020Quote: ... We then injected the AAV5.CamKII.GCaMP6f.WPRE.SV40 virus (Addgene # 100834; 200 nL at 1 nl.s-1) in hippocampal CA1 using the following coordinates ...
-
bioRxiv - Neuroscience 2022Quote: ... a 1:1 mixture (100 nl total) of either retrograde AAV-hSyn-DIO-eGFP (Addgene) and AAV2-hSyn-mCherry (UNC vector core ...
-
bioRxiv - Neuroscience 2024Quote: ... a 1:1 mixture of AAV8-hSyn-DIO-EGFP (2.3 x 1013 CG/mL, Addgene) and AAV8-Flex-3mts-mScarlet (1.14 x 1013 CG/mL ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No. NR-52310: BEI Resources) or VSV-G (a gift from Tannishtha Reya (Addgene plasmid # 14888 ...
-
bioRxiv - Cell Biology 2020Quote: Two previously described sgRNAs specific to the Kap1 gene10 (Supplementary Table 2) were incorporated into plentiGuide-puro vector (Addgene #52963). For production of lentiviral particles ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Microbiology 2021Quote: ... pEZY-FLAG-Nsp14 vector was constructed from pDONR223 SARS-CoV-2 Nsp14 vector to the pEZY-FLAG (Cat # 18700, Addgene) destined vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... and gGene-N2a and gGene-N2b for Nickase 2) cloned into tandem U6 cassettes in a version of pX330 plasmid (pX330-U6-Chimeric_BB-CBh-hSpCas9, Addgene #42230) mutated to express Cas9D10A-T2A-GFP (Nickase-1/2) ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Biophysics 2022Quote: Live cell Mpro proteolytic cleavage activity assays were performed by co-transfecting HEK 293T cells with either the pmNG-Mpro-Nter-auto-NLuc or the pmNG-Mpro-Nter-auto-L-NLuc Mpro sensor plasmid constructs along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...