Labshake search
Citations for Addgene :
851 - 900 of 2427 citations for 2 Methyl 4 piperidin 1 ylsulfonyl phenylboronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075; http://n2t.net/addgene:158075; RRID:Addgene_158075). The RBD amino acid sequence 328-537 encoded in this plasmid is identical to the sequence of RBD that we studied here ...
-
bioRxiv - Biochemistry 2024Quote: ... and T7 Ocr (NCBI Accession # NP_041954.1) genes were cloned into UC Berkeley Macrolab vectors 2-BT (Addgene #29666) and 13S-A (Addgene #48323 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-mDlx-GCaMP6f-Fishell-2 was a gift from Gordon Fishell (Addgene plasmid # 83899-AAV1; http://n2t.net/addgene:83899; RRID:Addgene_83899), was infected in 4 DIV neurons and imaged 12-13 DIV inhibitory interneurons ...
-
bioRxiv - Cancer Biology 2022Quote: ... pENTR4-FLAG (w210-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17423 ; http://n2t.net/addgene:17423 ; RRID:Addgene_17423), pGP (retroviral Pol and Rev gene plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received 2 separate unilateral microinjections (males 0.2 µL, females 0.15 µL) of retrograde-transported AAV (AAVretro) constructs (Addgene) in the RVLM and CVLM (RVLM-males ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-HEK 293T cells were generated using the CRISPR/Cas9 system from Addgene (http://www.addgene.org/). The sequences for guide RNAs were obtained from http://tools.genome-engineering.org and https://www.addgene.org/pooled-library/zhang-human-gecko-v2/ ...
-
bioRxiv - Cell Biology 2023Quote: Day 5 moDCs previously transfected with either NT or gal9 siRNA were transfected with 2 ug of the Str-KDEL_TNFα_SBP_EGFP plasmid (Addgene, #65278) (Boncompain et al ...
-
bioRxiv - Biochemistry 2023Quote: ... P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746; http://n2t.net/addgene: 23746; RRID:Addgene_23746) (Johannessen et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Gentamicin-R and Kanamycin-R) were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677; http://n2t.net/addgene:72677; RRID:Addgene_72677) or alternatively ...
-
bioRxiv - Biochemistry 2024Quote: BFP- and sgRNA-encoding lentiviruses were produced by co-transfecting 2 µg of pCMV-VSV-G (Addgene, #8454), 3 µg of psPAX.2 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pWPXLd-OGT-GFP fusion vector was described in our previous articles,(2) pET24a-ncOGT-FL (190821, Addgene), other plasmids were cloned into pcDNA3.1 backbone with c-myc or HA tag ...
-
bioRxiv - Bioengineering 2024Quote: ... and [2] pRSV-Rev was a gift from Didier Trono (Addgene plasmid 12253 ; http://n2t.net/addgene:12253 ; RRID:Addgene_12253)) altogether with transfer vector into Hek cells delivered by lipofectamine 3000 reagent ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with DuProSense biosensor containing Mpro cleavage sites and pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 (Fig ...
-
bioRxiv - Biophysics 2024Quote: HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid DNA and either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 or Nsp3-EGFP (PLpro ...
-
bioRxiv - Biophysics 2024Quote: ... equal amounts of both pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 and Nsp3 -EGFP (PLpro ...
-
bioRxiv - Biophysics 2024Quote: ... and pmNG-Mpro-NLuc-PLpro-mScarlet either alone or co-transfected with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 or Nsp3 -EGFP (PLpro WT ...
-
bioRxiv - Biophysics 2024Quote: HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid DNA and pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 plasmid DNA in 96-well white flat bottom plates ...
-
bioRxiv - Biophysics 2024Quote: ... along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 or Nsp3 -EGFP (PLpro ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were co-transfected with mSca-containing DuProSense biosensor plasmid along with pLVX-EF1alpha-SARS-CoV-2-nsp5-2×Strep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan; Addgene #141370; http://n2t.net/addgene:141370; RRID:Addgene_14137)96 and Nsp3 -EGFP (PLpro WT ...
-
bioRxiv - Cell Biology 2022Quote: Kinesin-1-GFP: Plasmid coding for kinesin-1-GFP was purchased from Addgene repository (#129761) ...
-
bioRxiv - Biophysics 2022Quote: ... Kinesin 1 1-401 (K401) was PCR amplified from pWC2 plasmid (Addgene # 15960). Ncd 236-701 was PCR amplified from a plasmid gifted by Andrea Serra-Marques.
-
bioRxiv - Cancer Biology 2024Quote: ... NKX2-1 and mouse Foxa2 CDS were amplified using NKX2-1 (Addgene, #119173) and mFoxa2 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Bioengineering 2023Quote: ... we followed the protocol of our previous study20 to transfected 6 individually isolated fibroblast lines with 4 μg of episomal plasmid (#58527; Addgene, Watertown, MA, USA) using the NucleofectorTM II with the A-024 program (Amaxa ...
-
bioRxiv - Neuroscience 2024Quote: ... For fiber photometry experiments Fig 4 and 4S: dual virus strategy of AAVretro-pEF1a-DIO-FLPo-WPRE-hGHpA (Addgene; 87306-AAVrg; 7×10e12) in PPN and AAVDJ-hEF1a-dFRT-jGCaMP7s(rev)-dFRT-WPRE-hGHp(A ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Systems Biology 2021Quote: ... We generated two independent miR-290-295_KO mESC lines by transfecting WT E14 mESCs with pX458-sgRNA_miR290-295_3/2 for KO1 (Addgene #172711, #172710) and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710) ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Two closely spaced NHSL1 specific sgRNA (sgRNA1: caccgTCGACTCTCCTCGTCCAAGT; sgRNA2: caccgCTGTCCACTACACGGCACCA) were designed using http://crispr.mit.edu and cloned into pX330S-2 (Addgene 58778) and pX330A_D10A_x2 (Addgene 58772 ...
-
bioRxiv - Molecular Biology 2022Quote: The lentiviral vectors pLVX-EF1alpha-IRES-Puro-2xStreg-SARS-CoV-2 (Nsp6, Nsp8, M) (Addgene plasmids #141395, #141372, #141374) were transfected into the HEK293T cells with packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068 ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Immunology 2021Quote: ... Virus was harvested from GP-2 cells transfected with SINV vectors and VSV-G (pMD2.G, Addgene plasmid #12259) and grown in DMEM supplemented with 30% FBS and 2mM glutamine ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs from the library (Supplemental Table 2) were annealed and cloned into a pLKO.1_neo plasmid (a gift from Sheila Stewart; Addgene plasmid # 13425 ...
-
bioRxiv - Neuroscience 2020Quote: ... mEos3.2-C1 was a gift from Michael Davidson & Tao Xu (Addgene plasmid # 54550; http://n2t.net/addgene:54550; RRID: Addgene_54550). Vcl-T-mEOS3.2-LifeAct was generated by sub-cloning a Vcl-T-T2A fragment in mEOS3.2-LifeAct clone.
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260), and pMD2G envelope plasmid (4 µg ...
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...
-
bioRxiv - Neuroscience 2022Quote: ... excitatory Gq-coupled DREADDs (hSyn-hM3Dq-mCherry-AAV1/2 viral stocks, 4.0 × 1011 GC/mL titer, plasmid #50474 from Addgene), and control construct (hSyn-enhanced green fluorescent protein (EGFP)-AAV2 1:10 dilution of viral stocks ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagging of the endogenous locus of SMC3 was done according to the CRISPaint protocol57 using 2.5 μg frame selector plasmid (pCAS9-mCherry-Frame+2; Addgene_6694157), 2.5 μg target selector plasmid (pCS446_pSPgSMC3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were produced in HEK293T cells using packaging and envelope constructs pCMVΔ8.2 and pMD.G-VSV-G (pCMVΔ8.2 and pMD.G-VSV-G were gifts from Bob Weinberg, Addgene plasmids #8454, #8455), and concentrated using fast-trap virus purification and concentration kit according to manufacturer′s instructions (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... into the DR and bilateral infusions of AAVretro-hSyn-DIO-EGFP (200 nL over 2 min; 1.3 x 1013 GC/mL, Addgene) into the BLA ...
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... PLD3 KO cell line was generated from HEK293BlueTM hTLR9 by transfecting 2 μg hSpCas9-sgRNA expressing plasmid (Addgene #99154) cloned with gRNA sequence 5′-guccucauucuggcgguugu-3′ ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Systems Biology 2023Quote: ... psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260)) ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255; http://n2t.net/addgene:141255; RRID: Addgene_141255). NSP1 coding sequence was cloned into the mammalian expression pCDNA5-FRT/TO-2xSTREP-3xHA vector ...