Labshake search
Citations for Addgene :
851 - 900 of 1243 citations for 6 chloro 9H 3 C methyl β D ribofuranosyl purine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3.7 μg pLenti6.3-HA-NL-tetraspanin plasmids or pLenti6.3-CD63-pHluorin plasmid were co-transfected with 0.9 μg pREV (Addgene, 12253) and 1.8 μg pRRE (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Genetics 2020Quote: ... Ishikawa cells were plated at a density of ~300,000 cells per well in 6 well plates and transfected the following day with 1650 ng Cas9 plasmid (Addgene 62988, a gift from Feng Zhang), 550 ng of each guide RNA (Table S2) ...
-
bioRxiv - Neuroscience 2019Quote: ... and AAVrg pmSyn1-EBFP-Cre (titer: 6×1012 vg/mL, this construct was a gift from Hongkui Zeng to Addgene-viral prep # 51507-AAVrg (38)) ...
-
bioRxiv - Immunology 2019Quote: ... Cas9-expressing recipient-cells either iCasp1−/−/Casp11−/− or iNlrc4−/− (1,000,000 cells/well in 6-well plates) were generated by lentiviral transduction with Cas9-expressing lentiviral vector (lentiCas9-Blast, Addgene 52962, from Feng Zhang lab) and then infected with the lenti-Guide viral particles in presence of 8μg/ml polybrene and centrifugated for 2 h at 2900 rpm at 32°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequence encoding the Dam-mCherry-double degron fusion was cloned and introduced into the lentiviral vector pCW57.1 (plasmid #41393; Addgene, gift from D. Root, Genewiz). A stably expressed RPE-1 megaDam cell line was obtained by antibiotic selection (puromycin).
-
bioRxiv - Biophysics 2020Quote: ... Lentiviruses were produced in 293T cells by transfecting lentiviruses with the helper plasmids pMD2.G and psPAX2 (a gift from D. Trono, Addgene plasmids #12259 and #12260), following Addgene’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... glycans were released by treatment with 2.0 µL of PNGase F for 20 hr at 37°C (in-house, Addgene #114274 ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were digested with 2.0 µL of PNGase F for 20 h at 37°C (in-house, Addgene #114274 ...
-
bioRxiv - Immunology 2021Quote: ... and a plasmid encoding the spike protein (with a C-terminal truncation) from either SARS-CoV (Addgene cat 170447), SARS-CoV-2 53 ...
-
bioRxiv - Cancer Biology 2020Quote: ISG15-PA was synthesised in the Kessler lab using the ISG15 C-term (79-156) construct from Addgene (#110760) and DUB ABP assays were performed as previously described69 ...
-
bioRxiv - Neuroscience 2020Quote: ... Dphox and phox vectors were C-terminally tagged with GFP by infusion cloning in frame into CAG-GFP (Addgene) using the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... was digested with NheI/KpnI and ligated with similarly digested pPD96.52 (Fire lab C. elegans Vector Kit 1999; 1608: L2534, Addgene) to generate pKMC166 (myo-3p::mCherry) ...
-
bioRxiv - Developmental Biology 2022Quote: ... that contain DENDRA-expressing sequences optimized for use in C. elegans (Gallo et al. 2010) are annotated in Addgene as containing DENDRA2 (e.g., pEG545, Addgene plasmid #40116 and pEG345 ...
-
bioRxiv - Biochemistry 2022Quote: The C-terminal P2A-EGFP sequence was added to SaABE8e or pCMV-PE2 (Addgene IDs 138500 and 132775, respectively), and the N-terminal BPNLS was added to an SpCas9 plasmid similar to pCMV-T7-SpCas9 (Addgene plasmid ID 139987 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806; http://n2t.net/addgene:79806; RRID: Addgene_79806)66 ...
-
bioRxiv - Cell Biology 2019Quote: ... The h-Fyn gene source was from pRK5-c-Fyn (a gift from Dr. Filippo Giancotti, Addgene plasmid # 16032). Biosensors were constructed using gene fusion ...
-
bioRxiv - Cell Biology 2019Quote: ... The sequence encoding mRuby2 fused to the C-terminus of Paxillin was cloned into the pMSCV retroviral backbone (Addgene). Transduced mRuby2-positive cells were single cell cloned by automated cell deposition unit using a BD FACSAria (BD biosciences) ...
-
bioRxiv - Biochemistry 2021Quote: ... the specific sybody and the C-terminal MBP were cloned in parallel into the expression vector pBXNPH3M (Addgene #110099) 38–40 using FX cloning 41 ...
-
bioRxiv - Genetics 2020Quote: ... The guides were inserted into a deadCas9-KRAB-T2A-GFP lentiviral backbone containing both the guide RNA under the U6 promoter and dead-Cas9-KRAB and GFP under the Ubiquitin C promoter (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, a gift from Charles Gersbach, Addgene plasmid #71237 RRID:Addgene_71237). The guides were inserted into the backbone using annealed oligos and the BsmBI cloning site ...
-
bioRxiv - Cell Biology 2020Quote: ... The codon-optimized mCherry sequence with synthetic introns and a C-terminal linker was amplified from pJJR83 (Addgene #75028). Correct amplification and assembly was confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length and C-terminal truncated KDM6B cDNA was amplified by PCR from KDM6B plasmids (Addgene, #21212 and #21214) and subcloned into pLVX-Ubc-FLAG vector ...
-
bioRxiv - Biochemistry 2020Quote: ... After cooling on ice for five min the sample was treated with 5.0 µL of PNGase F for 20 hr at 37 °C (in-house, Addgene #114274 ...
-
bioRxiv - Cell Biology 2021Quote: ... Either a control vector (c-Flag pcDNA3 was a gift from Stephen Smale (Addgene plasmid #20011; http://n2t.net/addgene:20011; RRID:Addgene_20011(47)) ...
-
bioRxiv - Cell Biology 2022Quote: ... hTERT-RPE1 Plk1 FRET Sensor cells were prepared by transfecting Plk1-FRET sensor c-jun substrate plasmid37 (Addgene: 45203) in hTERT-RPE1 cells using X-tremeGENE™ 9 (Merck ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Dnmt3a CD and the C-terminal part of mouse Dnmt3L (3a3L) were amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827). The resulting constructs (collectively ...
-
bioRxiv - Cell Biology 2023Quote: ... mRuby2-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 55889; http://n2t.net/addgene:55889; RRID: Addgene_55889). PaGFP-UtrCH was a gift from William Bement (Addgene plasmid # 26738 ...
-
bioRxiv - Cell Biology 2023Quote: ... mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149; http://n2t.net/addgene:57149; RRID: Addgene_57149). pBa-KIF5C 559-tdTomato-FKBP was a gift from Gary Banker (Addgene plasmid # 64211 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCDH-Flag-c-MYC was a gift from Hening Lin (Addgene plasmid # 102626; http://n2t.net/addgene:102626; RRID: Addgene_102626).
-
bioRxiv - Microbiology 2023Quote: ... Pmyo-3::mCherry] by cloning 1397bp promoter and 1266bp coding sequence of col-51 in frame with GFP into the vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene) and microinjecting to N2 worms.
-
bioRxiv - Neuroscience 2023Quote: ... The guides were inserted into a deadCas9-KRAB-T2A-GFP lentiviral backbone containing both the guide RNA under the U6 promoter and dead-Cas9-KRAB and GFP under the Ubiquitin C promoter (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, a gift from Charles Gersbach, Addgene plasmid #71237 RRID:Addgene_71237). The guides were inserted into the backbone using annealed oligos and the BsmBI cloning site ...
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted into a pcDNA3.1-Hygro(-)-like with a C-terminal HRV 3C cut site and human Fc tag amplified from Addgene plasmid 145164 using standard cloning techniques ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We first constructed pKB11 by replacing the TRP1 auxotrophic cassette of pDEST-DHFR F[1,2]-C (TRP1) (Addgene #177795) (Marchant et al ...
-
bioRxiv - Cell Biology 2024Quote: Plk1 FRET sensor c-jun substrate was a gift from Michael Lampson (Addgene plasmid #45203; http://n2t.net/addgene:45203; RRID:Addgene 45203). Cells were transiently transfected with a and plated onto glass-bottom plates ...
-
bioRxiv - Molecular Biology 2024Quote: ... The G418 (Geneticin) resistance gene was subcloned from pDEST-CMV-C-eGFP (a gift from Robin Ketteler, Addgene: 122844) and inserted into pLX303-DD-HA-ER-I-PpoI using In-Fusion cloning ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Cell Biology 2020Quote: ... designed by Life technologies to target the second exon of murine Vangl2 (gRNA: 5’-TCGGCTATTCCTACAAGTC-3’) into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138). Upon transfection ...
-
Cytonemes coordinate asymmetric signaling and organization in the Drosophila muscle progenitor nichebioRxiv - Developmental Biology 2022Quote: ... The T2A-nls:Gal4:VP16-STOP sequence was generated by PCR (Supplementary Table 3) from the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB vector (Addgene). 5’HA-T2A-nls:Gal4:VP16-STOP-3’HA was assembled in correct 5’-to-3’ order between Not1 and EcoR1 sites of the pJet1.2 vector.
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Genomics 2020Quote: ... and a revers primer (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-GTGTCTCAAGATCTAGTTACGCCAAGC-3′) were used to amplify 222 bp fragments from CROPseq-Guide-Puro plasmids (#86708, Addgene) which have been inserted with different gRNA sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... sgRNAs that target the 3′ end of the respective coding sequences were cloned into hSpCas9 plasmid (PX458, Addgene Plasmid #48138) (Ran et al ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Ring1b (5’-ACAAAGAGTGTCCTACCTGT -3’) were introduced into a modified version of the vector plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) that yields a BFP marker for selection (Gift by J ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Microbiology 2019Quote: ... full length VPA0226 was amplified using primers 3’ GATC AGATCT ATGATGAAAAAAACAATCACACTA 5’ and 5’ GATA GAATTC G GAAACGGTACTCGGCTAAGTTGTT 3’ and cloned in frame with GFP into the expression vector sfGFP-N1 (41) (Addgene) between BglII and EcoRI sites for the expression of C terminally tagged VPA0226 ...