Labshake search
Citations for Addgene :
801 - 850 of 1243 citations for 6 chloro 9H 3 C methyl β D ribofuranosyl purine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309; http://n2t.net/addgene:48309; RRID:Addgene_48309) via ligation-independent cloning (primer sequences ...
-
bioRxiv - Immunology 2020Quote: mApple-Dectin1A-C-10 was a gift from Michael Davidson (Addgene plasmid # 54883; http://n2t.net/addgene:54883; RRID:Addgene_54883). pEGFP-DC-SIGN was a generous gift from Ken Jacobson[12] ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNA of human CAV1 was PCR amplified from the mammalian expression plasmid Emerald-CAV1 C-10 (Addgene No ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 54967; http://n2t.net/addgene:54967; RRID:Addgene_54967).
-
bioRxiv - Molecular Biology 2021Quote: ... and miRFP2 genes were PCR amplified and swapped with mClover2 in pmClover2-tubulin-C-18 plasmid (Addgene #56376) and with TagRFP675 in pTagRFP675-actin-C1 (Addgene #44277 ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-MAP4-C-1069 was a gift from Michael Davidson (Addgene plasmid # 54152; http://n2t.net/addgene:54152; RRID:Addgene_54152). MAP9 in pCR-XL-TOPO (#BC146864 ...
-
bioRxiv - Microbiology 2022Quote: ... mEmerald-MAP4-C-10 (a gift from Dr. Michael Davidson (Addgene plasmid # 54152; http://n2t.net/addgene:54152; RRID:Addgene_54152)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... before using LR reaction to transfer the cDNA into destination vectors pLEX_305-C-dTAG or pLEX_305-N-dTAG (Addgene #91797 & #91798 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The amplicons were subsequently combined with a level 0 C-terminal 6xHis tag module pICSL50025 (Addgene plasmid # 174589) and either pOPARA1 ...
-
bioRxiv - Genomics 2023Quote: ... The W3 terminator was cloned from Cbh_v5 AAV-saCBE C-terminal (a gift from David Liu, Addgene plasmid #137183, RRID:Addgene_137183)22 and inserted at the EcoRI-XhoI multiple cloning site by Gibson assembly ...
-
bioRxiv - Genomics 2023Quote: ... FKBP12F36V-mNeonGreen-V5 (for C-terminal tagging) was amplified from pAAV-hSOX9-dTAG-mNeonGreen-V5 (Addgene plasmid #194971).
-
bioRxiv - Genomics 2023Quote: ... was performed at 50 °C with a mixture of Bsp119I-digested Lenti-Neo-iCas9 (Thermo FD0124; Addgene #85400), dCas9-KRAB-MeCP2-T2A amplicon ...
-
bioRxiv - Physiology 2023Quote: ... plus a five-amino-acid linker plus a C-terminal flag tag was cloned into the pENN.AAV.CB7.CI.pm20d1flag.WPRE.rBG vector (Addgene plasmid no. 132682). AAV8-GFP (pENN.AAV.CB7.CI.eGFP.WPRE.rBG),used as control ...
-
bioRxiv - Cancer Biology 2024Quote: ... mRFP with a C-terminal KDEL sequence (ER-mRFP) was PCR amplified out of ER-mRFP (Addgene, 62236) using the forward primer 5’-GGTCGGATCCGCCGCCACCATGGACAGCAAAGG-3’ and the reverse primer 5’-GAGGCACCGGTGTTTAGAGCTCATCTTT-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN or non-targeting-control (see Table 3) were cloned into pLKV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene ID:67974) and Cas9 expressing cell lines were transduced and selected with puromycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR and products were cloned into NheI and EcoRV restriction sites (Table 3: marked with blue) of pcDNA3.1-hygro vector (Addgene, kindly provided by Mark Richards-Bayliss group ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2014 to clone the annealed oligos into pCFD3-dU6:3-gRNA plasmid (Addgene, plasmid# 49410, Port et al., 2014). Transformants were verified via Sanger sequencing (Genewiz ...
-
bioRxiv - Cell Biology 2019Quote: ... and Firefly Luciferase (5’-TGAAGTCTCTGATTAAGTA-3’) were cloned into the HpaI and XhoI restriction sites in pSICOR (Addgene RRID:Addgene_11579) (Ventura et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... Guides targeting col-ECRM and col-LCRM were inserted in the pCFD4: U6:3-gRNA vector (Addgene no: 49411) as described [58] ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Genomics 2021Quote: ... we performed 80 co-transfections of HeK293T virus packaging cells (at approximatelly 60-70% confluence on 10 cm dishes) with 3 μg of the pDECKO_mCherry plasmid library and 2.25 μg of the packaging plasmid pVsVg (Addgene 8484) and 750 ng of psPAX2 (Addgene 12260 ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Immunology 2022Quote: ... and mSGK3 exon 3 (TTCAAGACATTAAATGCAG) were designed using the online tool CHOPCHOP (http://chopchop.cbu.uib.no/) and cloned into TLCV2 (Addgene plasmid # 87360,) as described previously5455 ...
-
bioRxiv - Plant Biology 2022Quote: The longer and shorter transporter 3′ UTRs were cloned into the dual luciferase construct pGreen_dualluc_3′UTR_sensor at EcoRI sites (Addgene, Cat: 55206). The longer 3′ UTRs without AU-rich elements were amplified using flanking PCR methods ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Cell Biology 2022Quote: ... the full-length dFz2 ORF was amplified and then mScarlet-I was fused to its 3’ end (Addgene #85044). The dFz2-Scarlet fusiomn was then cloned into the UASp vector ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and Flailer primary neuronal cultures were infected at 3 DIV with AAV coding for GCaMP6s (Addgene #51086) and FL1 or control AAVs ...
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was injected into worms along with a plasmid containing transposase (pCFJ601, Peft-3::Mos1 transposase, Addgene #34874) and co-injection markers (pGH8 Addgene #19359 ...
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Genetics 2023Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722 ...
-
bioRxiv - Genetics 2023Quote: ... and a 3’ UTR harboring the WPRE element was cloned in the pT7-PEmax for IVT plasmid (Addgene 178113)2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542; http://n2t.net/addgene:62542; RRID: Addgene_62542). 250 ng/μl of Cas9 mRNA and 50 ng/μl of gRNA(s ...