Labshake search
Citations for Addgene :
851 - 900 of 975 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: To generate CRISPR/Cas9-mediated knockout lines, the sgRNA targeting TRIM37 (TRIM37Δ, 5′-ctccccaaagtgcacactga-3′) was cloned into the PX459 vector (#62988; Addgene) containing a puromycin resistance cassette ...
-
bioRxiv - Cancer Biology 2024Quote: Construction of JMJD6-V5 plasmid was previously summarized and pDEST Myc (#19878) tagged YBX1 plasmid was purchased from Addgene (5). PCR based deletion constructs of JMJD6 and YBX1 were made using primers described in Supplementary table 1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells at 80-90% confluence were transfected with 2.5-5 µg of plasmid DNA (pcDNA3-EGFP-Cdc42-wt, Addgene #12975) or 50-100 nM siRNA (CdGAP Smart pool or Cdc42 siRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus particles for CRISPR-dCas9-directed knockdown of b2m were generated after subcloning a 20 nt sequence (5’ GCC-GTC-GGG-AAG-GAG-AAC-TA-3’ against the 5’- UTR of b2m into pLV-hU6-sgRNA hUBC-dCas9-KRAB-T2a-Puro (gift from Charles Gersbach, Addgene plasmid # 71236 ...
-
bioRxiv - Cancer Biology 2024Quote: 5 x 106 B-ALL cells (NALM6, REH or SUP-B15) were transduced with lentivirus expressing IKZF1 specific (Addgene #69041) or scramble (Addgene #69040 ...
-
bioRxiv - Neuroscience 2023Quote: ... each of these viruses were mixed in a 4:1 ratio with AAV8-Ef1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (Addgene; Watertown, MA, USA) and injected with 300 nL per side ...
-
bioRxiv - Cell Biology 2023Quote: ... pcDNA3.1-myc-OGA(1-400) and (344)pcDNA3.1(+)-HA-nLaG6-(EAAAK)4-OGA(544-706)15 (gift from Christina Woo; Addgene plasmid 168095 and 168197). Additionally ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Cell Biology 2024Quote: ... expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA) and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Neuroscience 2024Quote: ... For fiber photometry experiments Fig 4 and 4S: dual virus strategy of AAVretro-pEF1a-DIO-FLPo-WPRE-hGHpA (Addgene; 87306-AAVrg; 7×10e12) in PPN and AAVDJ-hEF1a-dFRT-jGCaMP7s(rev)-dFRT-WPRE-hGHp(A ...
-
bioRxiv - Neuroscience 2024Quote: ... Gq DREADD virus (n=23, 12 males, 11 females: AAV8-hSyn-DIO-hM3Dq-mCherry, ≥ 4×101 2 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express excitatory designer receptors in VP GABA neurons ...
-
bioRxiv - Cell Biology 2020Quote: ... using primer sequences 5’-TGTACCGGTCTCGAGGCCACCAT-GGTGGGTGAGG and 5’-AGATCCGGAGCTGTG-CCCCAGTTTGCTA, and cloned in place of EGFP in pT7-EGFP-C1-HsDCP1a (Tritschler et al., 2009) (Addgene # 25030). We then excised the FP635-DC-P1a cassette and blunt cloned into d2EGFPβ-glo-bin-UTR in place of the d2EGFP coding region.
-
bioRxiv - Genetics 2021Quote: mks-3::gfp transgenes were generated with PCR-based fusion of mks-3 gDNA (including 485 bp of 5’ UTR sequence) with GFP (pPD95_77, gift from Andrew Fire, Addgene plasmid #1495). All primers are listed in Table S4 ...
-
bioRxiv - Genetics 2020Quote: Flies expressing a gRNA targeting the rosy (ry) locus (5’-CATTGTGGCGGAGATCTCGA-3’) were generated by cloning the gRNA sequence into the pCFD3 plasmid (Addgene #49410) as in [44] ...
-
bioRxiv - Molecular Biology 2020Quote: ... All cell lines used to assess mitotic progression (Figures 5 and S7) were generated by co-transfecting pcDNA3 encoding mCherry-tagged Histone H2B (Addgene: 20972) and pcDNA3 encoding GFP-tagged Lamin B1 (a kind gift from David Vaux) ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN glia AAV-5: pZac2.1 gfaABC1D-cyto-GCaMP6f at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Developmental Biology 2020Quote: ... 5’–CACCTTTGCCACTCTCAAAGGGGA-3’ and sgRNA REV: 5’-AAACTCCCCTTTGAGAGTGGCAAA-3’) was cloned into a BbsI digested pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (42230; Addgene, Cambridge MA). Template DNA for in vitro transcription was generated by PCR amplification of the gRNA sequence—which included both the guide sequence as well as the scaffold sequence encoded in the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid—using Phusion HF DNA polymerase and a primer set (synthesized by IDT ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 sgRNAs targeting DIS3L2 (generated using the ChopChop tool (Labun et al., 2019)) were cloned into lentiGuide-Puro (Addgene #52963). The individual sgRNAs were subsequently transduced into MCF10a cells stably expressing pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911 ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence (5’-GCCCAATTCAGAGAGACATG-3’) targeting the genomic region immediately downstream the CDK12 start codon was cloned into the PX458 vector (Addgene 48138). The 3xFLAG knock-in repair template was constructed in a pTOPO-TA vector (Mei5bio ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Neuroscience 2020Quote: ... targeting exon 3 of the Prnp gene (5′-TCA GTC ATC ATG GCG AAC CT −3′) was cloned into the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene 50946,) to generate pKLV-Prnp sgRNA plasmid ...
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Microbiology 2021Quote: An sgRNA (5’-ATCACAACGATCTGTTCGTC-3’) targeting the LGMN gene was cloned into the PX459 plasmid (Addgene plasmid #62988 from Feng Zheng51) encoding Cas9 and puromycin resistance ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Immunology 2022Quote: The CRISPR target site for murine p53 (single guide (sg) RNA: 5’-CTGAGCCAGGAGACATTTTC-3’) was already cloned into a px330 plasmid (px330-U6-Chimeric_BB-CBh-hSpCas9, Addgene plasmid #42230) and for human p53 (sgRNA ...
-
bioRxiv - Immunology 2022Quote: ... and for human p53 (sgRNA: 5’-GCATCTTATCCGAGTGGA-3’) was already cloned into a px459 plasmid (pSpCas9(BB)-2A-Puro (px459) V2.0 (Addgene plasmid #62988)) and kindly provided by Daniel Hinze from the lab of Michael Hölzel ...
-
bioRxiv - Cell Biology 2022Quote: ... a 20bp guide sequence targeting the 5’ end of WNK1 exon 1 was ligated to the BbsI site of PX459 (Addgene #62988). In addition ...
-
bioRxiv - Cancer Biology 2022Quote: ... GCAAGATGATCCCAATGAGT) or Ifngr2-targeting sgRNAs (3’-gRNA-‘5: AGGGAACCTCACTTCCAAGT) were cloned into target vector px458-pSpCas9(BB)-2A-GFP (Addgene #48138) or px459-pSpCas9(BB)-2A-Puro (Addgene #62988) ...
-
bioRxiv - Cell Biology 2022Quote: ... The guide with the highest ranking in both scoring programs (5’-CGGCGCAACAGGTCGCGAACGGG-3’) was selected for cloning into the PX459 vector (Addgene, #62988), a non-lentiviral construct that also delivers Cas9.74 Oligos containing the gRNA sequences (5’-CACCGCGGCGCAACAGGTCGCGAAC-3’ and 5’-AAACGTTCGCGACCTGTTGCGCCGC-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Microbiology 2021Quote: ... Two single gRNA vectors containing either the 5’ or 3’ UTR-targeting gRNA were then generated using the pSAG1::Cas9-U6::sgUPRT plasmid as a backbone (Addgene #54467)5 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lentiviruses delivering sgRNA were packed by transfecting about 70% confluent HEK293T cells cultured in T75 flasks with 5 µg pCMV-VSVG (Addgene 8454), 10 µg pCMV-dR8.2 dvpr (Addgene 8455) ...
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCTCGTTCAGCACGGCCTCCA and reverse 5’- aaacTGGAGGCCGTGCTGAACGAGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987). To knock in eGFP into either the MFF or FIS1 loci ...
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCATTTAAATACAGTAAATAC and reverse 5’- aaacGTATTTACTGTATTTAAATGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987)10.
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Immunology 2020Quote: We using the 3*Flag sequence to replace the GFP protein in the pLenti CMV GFP Puro vector (Addgene, 658-5) for adding some Restriction Enzyme cutting site (XbaI-EcoRV-BstBI-BamHI ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Microbiology 2021Quote: Design of the guide RNA targeting the region between Dicer 5’-UTR and its first coding exon for CRISPR/Cas9 mediated knock-in was carried out using the CRISPOR Design Tool [86]. Annealed oligonucleotide corresponding to the gRNA (Supp. Table 5) were cloned into the vector pX459 (Addgene #48139) which also encodes S ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.5 million cells were resuspended in Mirus nucleofector solution and electroporated with 5 ug of px458 plasmid (Addgene plasmid #48138) containing a small guide RNA (see Table S1 for oligonucleotide information ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... Pairs of guide RNAs targeting upstream (5’) and downstream (3’) flanking sequences were designed and cloned into LentiCRISPRv2-GFP (Addgene #82416) and LentiCRISPRv2-mCherry (#99154 ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Neuroscience 2023Quote: ... 2014) AAV2-hSyn-DIO-hM4D(Gi)- mCherry vector (titer ≥ 5×10¹² vg/mL) was attained from AddGene (catalog number 44362-AAV2). Rats were anesthetized with 2.5% isoflurane ...
-
bioRxiv - Genomics 2023Quote: ... a plasmid encoding a sgRNA that targets the 5’ coding sequence of bc10 (GP01409) was co-injected with pCRISPaint-T2A-Gal4-3xP3-RFP (Addgene #127556) into nos-Cas9attP40 embryos ...
-
bioRxiv - Neuroscience 2023Quote: ... were coated with 200 nL of a 1:1 mixture of 5% silk fibers and AAV9.CaMKII.GCaMP6f.WPRE.SV40 (Addgene viral prep # 100834-AAV9), as previously described by 70 ...
-
bioRxiv - Bioengineering 2023Quote: ... gBlocks were created for this sequence with a C-terminal “LPETG” Sortase recognition site and complementary 5’ and 3’ overhangs to the BamHI/HindIII double digested pCARSF63 Thioredoxin-SUMO fusion expression plasmid (Addgene #64695).89 The resulting gBlocks were ligated into pCARSF63 expression plasmids using Gibson assembly (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Genomics 2024Quote: ... respectively),25 modified scaffold sequence was 5′GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC,60 and RNA structural motif for epegRNAs was tevopreQ1 (5′-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA).40 pegRNAs and epegRNAs used the pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μg of pT/Caggs-NRASV12 or pT/Caggs-NRASV12/D38A and 5 μg of PT2/c-Luc//PGK-SB-13 (Addgene, 20207) were suspended in 0.9% saline solution at a final volume of 10% of the body weight and injected via the tail vein within 8 seconds ...