Labshake search
Citations for Addgene :
851 - 900 of 1338 citations for 2 Triisopropylsilyl Oxazole 5 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... or Ring1b (5’-ACAAAGAGTGTCCTACCTGT -3’) were introduced into a modified version of the vector plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) that yields a BFP marker for selection (Gift by J ...
-
Basolateral amygdala parvalbumin neurons report aversive prediction error to constrain fear learningbioRxiv - Neuroscience 2020Quote: ... AAV5-ef1α-DIO-hChR2(H134R)-eYFP (5.5×1012 GC/ml) (pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA was a gift from Karl Deisseroth (Addgene viral prep # 20298-AAV5 ...
-
bioRxiv - Cell Biology 2021Quote: ... For CRISPR Cas9 KO generation two gRNA directed to exon 4 and exon 5 (Table M1) were cloned in pSpCas9 (BB)-2A-Puro V2.0 (Addgene #62988).
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA (sgRNA) targeting exon 4 of TP53 (5’-CTGTCATCTTCTGTCCCTTC-3’) was cloned into pSpCas9(BB)-2A-GFP (pX458, plasmid #48138, Addgene). pSpCas9(BB)-2A-GFP was a kind gift from dr ...
-
bioRxiv - Cell Biology 2021Quote: ... the fragments of 5’ and 3’ homology arms to target ROSA26 locus were subcloned into H2B-670 (modified from pmiRFP670-N1, #79987, Addgene) or FUCCI (kind gift from Ludovic Vallier’s lab ...
-
bioRxiv - Cell Biology 2021Quote: ... the fragments of 5’ and 3’ homology arms to target AAVS1 locus were subcloned into hOCT4 promoter containing phOCT4-EGFP plasmid (#38776, Addgene) using AAVS1 SA-2A-puro-pA donor plasmid (#22075 ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were infected at 5 days in vitro (DIV) with titer-matched viruses using pAAV-Syn-ChrimsonR-tdT (Addgene #59171) and pAAV2.5-TH-GFP (Addgene #80336) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse: 5’-AAAC-(N)19-20-3’) were designed and cloned in a zebrafish U6 promoter-driven vector (Addgene#64245) at BsmBI restriction sites according to the previous study (Jao et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsDNA repair templates were amplified using primers with 5’ SP9 modifications (IDT) from the pJRK86 plasmid (AID*::GFP, Addgene #173743) and mIAA7 repair template plasmids in table 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Figs. 4A-C, 5, and 7B,C, and Supplementary Movies 1,2; Salk Vector Core; 2.5 x 1012; Addgene plasmid #50973); AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 nM or 37.5 nM of preincubated binary complexes were added to 5 nM of target DNA (eGFP-hAgo2 plasmid (Addgene #21981) linearized with SmaI) ...
-
bioRxiv - Neuroscience 2022Quote: ... For the chemogenetic activation of 5-HT2cR we used AAV8-hSyn-DIO-hMD3q-mCherry and AAV8-hSyn-DIO-mCherry (UNC, Addgene). For the silencing of GLP1R mRNA we used AAV1.U6.shRGlp1r07.CB7.EGFP.SV40 (AAV1-shRNA-Glp1r ...
-
bioRxiv - Developmental Biology 2022Quote: ... The empty ctrl or MMP14-eGFP lentiviral plasmid (7.5 μg) was co-transfected into 293 cells with packaging plasmid pRSV-Rev (5 μg, Addgene #12253), pMDLg/pRRE (2.5 μg ...
-
bioRxiv - Genetics 2022Quote: ... with 5’ KpnI and 3’ EcoRI sites (primers LC127 and 128) into the corresponding restriction digestion sites of pLP9 (Addgene plasmid #1497 ...
-
bioRxiv - Neuroscience 2021Quote: Cre-dependent adeno-associated virus (AAV; serotypes 5 or 9) was used to express GCaMP6s (AAV5-Syn-Flex-GCaMP6s, Addgene), or GCaMP7f (AAV9-Syn-Flex-jGCaMP7f-WPRE ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Biochemistry 2020Quote: ... we used plasmids encoding hDicer 3’-pocket double mutant (Y926F, R927A), and the 5’-pocket sextuple mutant (R778A, R780A, R811A, H982A, R986A, R993A) (23) (Addgene). PCR fragments were subsequently cloned into the pMCSG7 vector (courtesy of Laboratory of Protein Engineering ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Microbiology 2020Quote: The nucleic acid sequences of N-terminal adhesin domains of CfaE and class 5 adhesins (GenBank M55661) were cloned into a pMAL-C5X vector (Addgene) in-frame with an MBP tag to express as periplasmic proteins with improved solubility (MBP–CfaE-N) ...
-
bioRxiv - Immunology 2021Quote: ... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2023Quote: ... The PAC sgRNA (5′-TGTCGAGCCCGACGCGCGTG-3′) (Lambrus et al., 2016) was cloned into the pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... The second 5’-HDNT allele was replaced by a similar puromycin cassette (puro-HSV-TK-loxP) amplified from the pHJ18 plasmid (Addgene) [65] using primers p47/p48 ...
-
bioRxiv - Neuroscience 2024Quote: ... PV-Cre mice (N = 5) were injected at the same coordinates with 250 nL of AAV-ef1a-Flex-iChloC-2A-dsRed (Addgene plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: To generate RAD54L2 knockouts a double-stranded DNA oligo encoding a sgRNA targeting the RAD54L2 5’ region from the TKOv3 library (Hart et al, 2017) (5’-AAGATGGGCAGCAGCCGCCG CGG–3’) was cloned into pSpCas9(BB)-2A-Puro (PX459) (RRID: Addgene_48139) to yield PX459-RAD54L2.
-
bioRxiv - Neuroscience 2024Quote: ... Rats then received bilateral infusions of either AAV8-CAMKIIa-hM3D(Gq)-mCherry or AAV8-CaMKIIa-GFP (5×1012 vg/mL for both viruses; Addgene) into the VH (either A/P ...
-
bioRxiv - Neuroscience 2024Quote: ... From 5’ to 3’ the constructs consist of a Tet-On doxycycline inducible promoter (a gift from David Root (Addgene plasmid # 41393 ...
-
bioRxiv - Genetics 2024Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
-
bioRxiv - Neuroscience 2024Quote: ... were cloned by ligating annealed oligonucleotide pairs (Supplemental table 5) into the BsmBI-digested pBPK1520 plasmid (BPK1520 was a gift from Keith Joung. Addgene#65777 ...
-
bioRxiv - Neuroscience 2024Quote: ... pegRNA plasmids for prime editing were cloned by ligating annealed oligonucleotide pairs (Supplemental table 5) into the BsaI-digested pU6-peg-GG-acceptor (pU6-pegRNA-GG-acceptor was a gift from David Liu. Addgene #132777 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Biochemistry 2023Quote: ... IGF2BP3: 5’-ACGCGTAGCCAGTCTTCACC-3’) were cloned into the pSpCas9 (BB)-2A-GFP (PX458) (plasmid #48138; Addgene, (Ran et al. 2013)) ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 5; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Immunology 2022Quote: ... HHLA2 cDNA included 5’ EcoRI and 3’ NotI sites and was cloned into the pBMN-IRES-GFP vector (Addgene #1736). PCR (Q5 enzyme ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448; http://n2t.net/addgene:17448; RRID: Addgene 17448) (40) ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Neuroscience 2023Quote: ... Ntsr1-Cre and Rbp4-Cre mice were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” ...
-
bioRxiv - Cell Biology 2023Quote: ... A pair of 20-mer oligonucleotides targeting the 5’ end of the dtat coding sequence was ligated into pAc-sgRNA-Cas9 (Addgene) and validated by sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence used was 5’-TCTCTGAGTGCCAACGCGCG-3’ and was cloned into the BbsI site of pX459 vector (Addgene #62988). The gene targeting was performed by co-transfection of pX459 and the synthetic donor vector into B6N 6.0 embryonic stem cells using Lipofectamine 2000 ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
bioRxiv - Cancer Biology 2024Quote: 5’ UTR elements or part of the GAPDH gene body102 were cloned into the dual luciferase assay construct (Addgene:45642). 1.5 million cells/6cm plate were transfected with 2μg of the construct using lipofectamine 2000 at a ratio of 3:1 lipofectamine to μg DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... A virus lacking the Arch-T gene and instead containing the fluorescent tag eYFP (n=5, AAV9-CaMKIIa-EYFP, packaged by Addgene) was infused into ACC as a null virus control ...
-
bioRxiv - Neuroscience 2024Quote: A small craniotomy was drilled above the right Anterior Cingulate Cortex (AP: +1, ML: -0.3, DV: -0.9) and 0.2μl of AAV1-CAG-tdTomato (59462-AAV1, Addgene, 5×10¹² vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Biochemistry 2024Quote: ... An oligonucleotide corresponding to a target sequence near the smo-1 translational start site (sgRNA #1: 5‘ GCCGATGATGCAGCTCAAGC 3‘) was cloned into the plasmid pMW46 (derivate of pDD162 from Addgene). The deletion of the eleven amino acids ADDAAQAGDNA at the SMO-1 N-terminus was achieved using the oligonucleotide pAF64 as repair template ...
-
bioRxiv - Genomics 2024Quote: ... 20Q1 Cancer Dependency Map common essential genes (https://depmap.org/portal/download/) and (ii) 5% non-targeting control sgRNAs cloned into pJR101 (Addgene #187241). A second sgRNA library (dJR092 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the HDR donor plasmid derived from Mouse 5’ Npm1-AID-GFP-PuroR plasmid (a gift from Mark Groudine, Addgene plasmid #127899 ;http://n2t.net/addgene:127899 ...
-
bioRxiv - Molecular Biology 2024Quote: ... ESCs were co-transfected with a plasmid expressing Cas9 protein and the gRNA sequence targeting the NPM1 locus (pX330 Mouse 5’ Npm1 gRNA, a gift from Mark Groudine, Addgene plasmid #127900 ...
-
bioRxiv - Cancer Biology 2024Quote: ... targeting a DNA sequence within the first exon of the FasL gene (5’-CTGGGCACAGAGGTTGGACA-3’) was cloned into the BsmBI restriction site of the 3rd generation LentiCRISPR.V2 (Addgene, #52961) vector ...