Labshake search
Citations for Addgene :
751 - 800 of 1338 citations for 2 Triisopropylsilyl Oxazole 5 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/2-hsyn-DIO-hM4D(Gi)-mCherry was obtained from Addgene (plasmid #44362, 4.6x1012 GC/ml). For optogenetic activation ...
-
bioRxiv - Molecular Biology 2024Quote: ... nsp1 coding sequences were amplified by PCR from pDONR207 SARS-CoV-2 nsp1 (WT, Addgene #141255), pDONR207 SARS-CoV-2 nsp1 Delta RC (M1 ...
-
bioRxiv - Microbiology 2024Quote: ... iBMDM cell suspensions were mixed with 2 µg of pEGFP VAMP2 (mouse; Addgene plasmid # 42308 (51). Cells were electroporated using the program FF-100 and immediately transferred to pre-warmed DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... rats received bilateral 2 uL viral injections of rAAV5 pZac2.1-GfaABC1D-Rpl22-HA (Addgene cat #111811) into the nucleus accumbens (6° angle ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pcDNA3-SARS-CoV-2-S-RBD-sfGFP was a gift from Erik Procko (Addgene plasmid #141184), and a his-tag was added to the C-terminus of the RBD-sfGFP open reading frame (ORF) ...
-
bioRxiv - Bioengineering 2024Quote: For transgene expression studies with AAV vectors we used the following AAV expression plasmid:pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA was a gift from Hirokazu Hirai (Addgene plasmid # 190163; http://n2t.net/addgene:190163; RRID:Addgene_190163)(1) ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Developmental Biology 2020Quote: The zebrafish gfap promoter 51 was derived from the Addgene plasmid: pEGFP-gfap(Intron1/5’/Exon1-zebrafish) (Addgene, #39761) and lssmKate2 65 was derived from the Addgene plasmid ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Bioengineering 2022Quote: ... and LT1 (305 μL) was combined with a DNA mixture of the packaging plasmid pCMV_VSVG (Addgene 8454, 5 μg), psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... and 5 mg sgRNA cloned into the BsmBI restriction site of the MLM3636 plasmid (gift from Keith Joung, Addgene plasmid #43860 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Neuroscience 2022Quote: ... and 210nl of Arch 3.0- eYFP (rAAV2-EF1a-double floxed-eArch3.0-eYFP; 5 × 1011 GC per ml; UNC Vector Core or eYFP (Addgene plasmid 20296 ...
-
bioRxiv - Neuroscience 2021Quote: Four mice (experimental group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-ChR2-WPRE-eYFP (Addgene viral prep 20298-AAV5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... This middle entry vector was Gateway recombined using a 5’ entry zebrafish ubiquitious promoter (Addgene #2732, Watertown, MA, USA), a 3’ entry pA vector ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CasX2 ORF was amplified from pBLO 62.5 (pBLO 62.5 was a gift from Jennifer Doudna and Benjamin Oakes, Addgene plasmid #123124; http://n2t.net/addgene:123124; RRID:Addgene 123124) [39] ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Neuroscience 2023Quote: A volume of 200 nL of pGP-AAV2/5-syn-FLEX-jGCaMP8m-WPRE (1.9×1012 pp/mL, Addgene; #162378) expressing the genetically encoded calcium indicator GcaMP8m was injected into the CA2 region of the right hemisphere at AP -2.0 mm ...
-
bioRxiv - Genetics 2023Quote: ... a pDestTol2CG2-eye-bfp with the independent marker beta-crystaline:BFP a kdrl P-5’entry clone (Addgene, Santoro Lab), an EGFP-CAAX p-middle entry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected the Cre-dependent constructs AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) and AAV-EF1a-DIO-eNpHR3.0-mCherry-WPRE (5×1012 gc/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-expressing BNST neurons were induced to express eYFP (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; Addgene_27056) for visualization of BNST AVP neurons.
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...
-
bioRxiv - Neuroscience 2024Quote: TRAP2 mice were bilaterally injected in the VTA with 0.3 μl of rAAV-hSyn-DIO-hM3Dq-mCherry (5 × 1012 gc/ml; Addgene), rAAV-hSyn-DIO-hM4Di-mCherry (4.2 × 1012 gc/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... were constructed by inserting annealed synthetic oligomers (5′-CACCgcagctcctgcctctcatcg-3′ and 5′-AAACcgatgagaggcaggagctgc-3′) into the Bbs I site of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene, Watertown ...