Labshake search
Citations for Addgene :
801 - 850 of 1514 citations for Recombinant Human CD19 protein His tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: GeCKO v2 human library made by Zhangfeng’s lab was purchased from Addgene (Watertown, MA, USA) amplified as described(Joung et al. ...
-
bioRxiv - Microbiology 2021Quote: Human furin was cloned in the sleeping beauty transposon plasmid26 pSB-bi-RP (Addgene #60513), transfected along with transposase ...
-
Sequence and structural variations determining the recruitment of WNK kinases to the KLHL3 E3 ligasebioRxiv - Molecular Biology 2020Quote: ... human KLHL3 (a.a. 298–587) was cloned into the pNIC28-Bsa4 vector (Addgene plasmid #110251), which provides an N-terminal hexahistidine tag as previously described [9] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Smad3 overexpression plasmid was constructed by subcloning human Smad3 cDNA into pcDNA3.0 backbone plasmid (Addgene). GAS5 adenoviral vector was constructed by inserting mouse GAS5 cDNA into pShuttle-IRES-hrGFP-1 vector (Agilent) ...
-
bioRxiv - Genetics 2021Quote: ... The TERT-immortalized human melanocyte cell C283T was infected with pCW-Cas9-Blast from Addgene followed by introduction of lentiGuide-Puro (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: U2OS cells harboring Doxycycline-inducible human RNF168 were generated using the pINDUCER20 lentiviral vector (Addgene plasmid # 44012 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reference sgRNA sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Immunology 2020Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 µL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting of SARS-CoV-2 pps ...
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Immunology 2020Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 μL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting SARS-CoV-2 pps ...
-
bioRxiv - Neuroscience 2021Quote: ... the human Synapsin (hSyn) promoter in pAAV-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, cat #: 50459) was replaced with mouse CaMKIIa promoter using MluI and SalI restriction sites to produce pAAV-CaMKII-DIO-hM4D(Gi)-mCherry and pAAV-CaMKII-DIO-mCherry ...
-
bioRxiv - Molecular Biology 2022Quote: The human metabolic knockout pooled CRISPR library was a gift from David Sabatini (Addgene # 110066). For lentivirus production ...
-
bioRxiv - Cell Biology 2022Quote: Full-length ERK3 wild type (WT) pDONR-223 construct purified from Human Kinase Library (Addgene) was used as a template to generate ERK3 K49A K50A kinase dead (KD ...
-
bioRxiv - Microbiology 2023Quote: ... GFP or human c-MET cDNA were PCR amplified from plasmid pLenti-MetGFP (Addgene #37560) and seamlessly cloned into the BamHI/XbaI sites of vector pLenti-spCas9-Blast (Addgene #52962) ...
-
bioRxiv - Biophysics 2023Quote: Human BAF57 and BAF155 gene fragments were amplified from plasmids pBS-hBAF57 (Addgene ID #17877) and pBS-hBAF155 (Addgene ID #17876) ...
-
bioRxiv - Neuroscience 2023Quote: Human iPSCs were edited using the pSpCas9(BB)-2A-GFP (PX458) construct backbone (Addgene #48138) described in Ran et al 201380 ...
-
bioRxiv - Molecular Biology 2023Quote: ... an shRNA targeting human UNK gene was cloned in the pLKO.1 puro plasmid (Addgene_8453) between AgeI and EcoRI sites61 ...
-
bioRxiv - Cell Biology 2023Quote: Coding sequence of human PITX2C (NM_000325.6) was cloned into lentivirus transfer plasmid (pWPI, Addgene#12254) using Gibson Assembly® kit (NEB ...
-
bioRxiv - Systems Biology 2022Quote: ... 240 million cells were transduced with lentivirus from the Human Genome-wide CRISPRi-v2 (Addgene #83969 ...
-
bioRxiv - Microbiology 2023Quote: ... Human codon-optimized full-length Eph receptors were subcloned from pDONR223-EphB1 (Addgene # 23930 (82)) ...
-
bioRxiv - Cancer Biology 2023Quote: The Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat (Addgene #90294). The library was amplified in bacteria as described in the Moffat protocol on Addgene (https://www.addgene.org/pooled-library/moffat-crispr-knockout-tkov3/) ...
-
bioRxiv - Cancer Biology 2023Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag-FKHR-AAA mutant; Addgene) (15) ...
-
bioRxiv - Cancer Biology 2023Quote: ... we amplified mutant human HIF1/2α using the pcDNA3-HA-HIF1α(P402A/P564A) (Addgene #18955) plasmid and the pcDNA3-HA-HIF2α(P405A/P531A ...
-
bioRxiv - Biochemistry 2023Quote: ... Human DNMT3A1 and DNMT3L constructs were PCR amplified from cDNA expression constructs (Addgene #35521, #35523) and cloned by ligation dependant cloning into x6His-MBP-TEV or 6xHis-MBP-GFP expression vectors ...
-
bioRxiv - Microbiology 2023Quote: The human CUL1 and UBE2L3 coding sequences were amplified from pcDNA-HA-UBE2L3 (Addgene, #27561) and pcDNA-myc3-CUL1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of human tau isoform 0N4R was subcloned into the pJFRC7 vector (Addgene, plasmid #26220 ...
-
bioRxiv - Cancer Biology 2024Quote: The Human CRISPR Metabolic Gene Knockout library was a gift from David Sabatini (Addgene #110066)78 ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first fragment was amplified using p15-Cam-F and p15-Cam-R (Table 1) from the plasmid pEVOL-pBpF (Addgene #31190), and the second fragment was obtained from the pBAD/HisB vector (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... or a human FIRRE cDNA plasmid (htransgene; Dharmacon BC03858) were each transfected together with the selectable marker pPGK-Puro plasmid (gift from R. Jaenisch; Addgene 11349) into ΔFirreXa cells using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... The Lenti-CMV-mCherry-P2A-CRE (aka pLM-CMV-R-Cre) plasmid was a gift from Michel Sadelain (Addgene plasmid #27546) (34) ...
-
bioRxiv - Cell Biology 2022Quote: ... T2A-GFP fragment was amplified by T2A-F and GFP-R primers using plenti-CMV-mCherry-T2A-GFP (Addgene plasmid #109427) as a template ...
-
bioRxiv - Pathology 2019Quote: ... the full length genomic copy with promoter of MoDNM1 was amplified with MoDnm1-F (5’-AATT GAATTC GTTGAGCAGGCCGAGCGAC-3’) and MoDnm1-R (5’-AATT GAATTC CACTGGCATTTGATTACGCAAGG-3’) inserted into pFGL822 (Addgene, 558226) and introduced into the Modnm1Δ strain.
-
bioRxiv - Cell Biology 2021Quote: ... Real time analysis of NFAT4-GFP nuclear translocation in response to 10 µM Cch stimulation was calculated using the equation: Quantification of ER Ca2+ store depletion and refilling was measured by transfecting parental and MCU-KO HEK293 cells with red R-CEPIA1er (Addgene: #58216) using Lipofectamine 24 hrs prior to imaging ...
-
bioRxiv - Biochemistry 2020Quote: D3cpV-px (PST 1738) was generated from (pcDNA-)D3cpV (kind gift from A. Palmer and R. Tsien (Palmer et al., 2006) (Addgene #36323)) by amplifying an insert with OST 1599 (GCGCATCGAT GGTGATGGCC AAGTAAACTA TGAAGAG ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 × 105 cells were resuspended in 10 μL of R-buffer with 0.5–2 μg of the EMTB 3x EGFP plasmid (a gift from William Bennett, Addgene plasmid 26741). Cells were exposed to three pulses of amplitude 1325 V and duration 10 ms in the electroporator ...
-
bioRxiv - Cell Biology 2022Quote: ... was amplified by PCR using oligonucleotide primers Pac1-paGFP-F (GGGTTAATTAACGTGAG-CAAGGGCGAGGAG) and Asc1-paGFP-R (AGTGGCGCGCCCTACTTGTACAGCTCGTCCATGCC) and the product was cloned into pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) digested with Pac1/Asc1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in transformed fibroblasts was achieved by transient expression of Cre recombinase by transfection with the plasmid pLM-CMV-R-Cre (Addgene, 27546), which codes for mCherry-Cre recombinase ...
-
bioRxiv - Plant Biology 2023Quote: ... we amplified a 10xHis-MBP coding fragment by PCR with primers pair 10xHis-MBP-F and 10xHis-MBP-R from pMAL-c2X® vector (Addgene), and cloned it into pTrcHis® vector (Addgene ...
-
bioRxiv - Immunology 2020Quote: Plasmids containing fluorescent protein coding sequences mCerulean3-N1 (Addgene # 54730), mAzurite-N1 (Addgene # 54617) ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp12 protein was expressed from pFastBac vector 438C (Addgene #154759) in Hi5 insect cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Synthetic Biology 2020Quote: Expression vector encoding humanized pCas9_GFP protein was obtained from Addgene.org (Plasmid #44719) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Expression vectors encoding Anti-CRISPR proteins were obtained from Addgene: AcrIIA2 (pJH373 plasmid ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a green florescence protein (GFP) derived from pJL1 (Addgene #69496), and a C-terminal twin-strep-tag (66) ...
-
bioRxiv - Biochemistry 2021Quote: ... or N-terminal His6 plus green fluorescent protein (GFP; RRID:Addgene_29716). Note that in the plasmid names for this clone the numbering of Syx residues was based on the Syx isoform from NCBI Reference Sequence NP_001036128.1 ...
-
bioRxiv - Genetics 2020Quote: ... and a blue fluorescent protein (BFP) expression cassette (Addgene #36086). The 1kb upstream and 1kb downstream arms were amplified from purified mouse genome from AB2.2 ES cells (ATCC #SCRC-1023 ...
-
bioRxiv - Genomics 2021Quote: ... Protein A (pA) was amplified from pK19pA-MN (ASP4062, Addgene plasmid #86973 ...
-
bioRxiv - Microbiology 2022Quote: ... we also expressed WT and D614 S-protein-FLAG (Addgene plasmids 156420 and 156421 ...