Labshake search
Citations for Addgene :
701 - 750 of 1514 citations for Recombinant Human CD19 protein His tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... HEK293T target cells transfected with 500ng of a human ACE2 expression plasmid (Addgene) were seeded at 2×104 in 100μL DMEM-10% in a white-bottomed 96-well plate (Corning ...
-
bioRxiv - Cancer Biology 2020Quote: The cDNA of human SNAI1 was subcloned from Flag-Snail WT (Addgene 16218) into pWZL-Blast-GFP (Addgene 12269 ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Developmental Biology 2020Quote: ... human MEG3 cDNA was PCR amplified from the pCI-Meg3 (Addgene Plasmid #44727) using NEB Q5 high-fidelity polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... human KIFC1(125-673) and mouse BICD2(15-595) were obtained from Addgene (plasmids #133242 ...
-
bioRxiv - Bioengineering 2022Quote: ... we utilized the Human Genome-wide CRISPRa-v2 Library (Addgene Pooled Libraries #83978) consisting of 104,540 sgRNAs targeting 18,915 genes (top 5 sgRNAs per gene) ...
-
bioRxiv - Cell Biology 2022Quote: Point mutations were generated on a human fibronectin pMAX vector plasmid (Addgene, #120402) using the Q5 site-directed mutagenesis kit (BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: Human ATG9A was amplified from pMXs-puro-RFP-ATG9A from Addgene (plasmid #60609) and subcloned into the EGFP-N1 vector ...
-
bioRxiv - Cell Biology 2023Quote: ... Human MCU-GFP plasmid was a gift from Vamsi Mootha (Addgene plasmid # 31732).
-
bioRxiv - Neuroscience 2023Quote: ... The human KIBRA sequence originated from the pBabepuro-KIBRA vector (80) (Addgene #40887). For lentiviral-based expression ...
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CRISPR Knockout library was a gift from Michael Bassik (Addgene #101927). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... a plasmid containing the human codon-optimized Cas12a gene was obtained from Addgene, then was PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... All the sgRNAs targeting human genes were cloned into lentiCRISPR v2 (Addgene, #52961), lentiCas9-Blast (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cdk5rap2 from mouse and human were cloned into FUGW (Addgene plasmid # 14883) [52] ...
-
bioRxiv - Molecular Biology 2024Quote: The gRNA library targeting >1500 human miRNA loci was obtained from Addgene (32). MutuI cells were transduced with lentiparticles derived from the doxycycline inducible Cas9 vector pCW-Cas9 (Addgene Plasmid #50661 ...
-
bioRxiv - Biochemistry 2024Quote: An expression plasmid of human GST-Cdk2 was purchased from AddGene (plasmid #61845) and used without further subcloning ...
-
bioRxiv - Biophysics 2024Quote: The coding sequence of human fascin1 (GeneBank, NM_003088.4) was obtained from Addgene (#31207) and subsequently inserted into a pGEX-6p-1 vector (Cytiva ...
-
bioRxiv - Neuroscience 2021Quote: Pyramidal cell imaging experiments were performed by injecting a recombinant adeno-associated virus (rAAV) encoding GCaMP6f (rAAV1-Syn-GCaMP6f-WPRE-SV40, Addgene/Penn Vector Core) into male wild-type mice.
-
bioRxiv - Microbiology 2020Quote: ... The UPS reporter construct Ub-R-GFP was obtained as a gift from Nico Dantuma (Addgene plasmid # 11938; http://n2t.net/addgene:11938; RRID:Addgene_11938) and sub-cloned into the pKT3 plasmid using the NheI and SmaI sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reporter assays to assess RUNX1 transcriptional activity were done using the pMCSF-R-luc plasmid (Addgene plasmid #12420; http://n2t.net/addgene:12420; RRID:Addgene_12420) (Zhang et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and nuclear (CMV-NLS-R-GECO) targeted calcium biosensors were gifts from Robert Campbell (Addgene #61244, and 32462) [40,41] ...
-
bioRxiv - Cell Biology 2021Quote: ... the sequence coding for R-GECO1 including TorA-tag from pTorPE-R-GECO1 (a gift from Robert Campbell (Addgene plasmid #32465; http://n2t.net/addgene:32465; RRID:Addgene_32465), and (iv ...
-
bioRxiv - Biophysics 2023Quote: ... generated by us in the Kiel center [51] using a modified version of the pHyVec1 plasmid which replaces the GFP sequence with a GCaMP6s sequence that was codon-optimized for Hydra (HyGCaMP6s was a gift from R. Yuste lab (Addgene plasmid # 102558; http://n2t.net/addgene:102558 ; RRID:Addgene_102558) [37]) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The TIS11B coding sequence was amplified from pcDNA3.1-puro-GFP-TIS11B using TIS11B MCP F and TIS11B MCP R primers and the TIAL1 coding sequence was PCR amplified from pFRT_TO_FlagHA_TIAL1 (Addgene 106090) using TIAL1 MCP F and TIAL1 MCP R primers.
-
bioRxiv - Cancer Biology 2023Quote: ... PGL2 E-cad (108) Ebox Mut-Luc (kindly provided Dr. Eric R. Fearon, Addgene plasmids 19291 and 19290), and 0.025 μg of pRL-TK (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK-293 cells were transfected with two plasmid vectors CMV–R-GECO1 (a gift from Robert Campbell, Addgene plasmid #32444 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK-293 cells were transfected with two plasmid vectors CMV–R-GECO1 (a gift from Robert Campbell, Addgene plasmid #32444; http://n2t.net/addgene:32444; RRID:Addgene_32444) and PH(Akt)-Venus (a gift from Narasimhan Gautam ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for mitochondria specific protein/ autophagosome specific protein is transfected in HEK293T cells along with packaging vector (pDR8.2; Addgene #8455) and envelope encoding protein (VSVG ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Systems Biology 2021Quote: ... and envelope protein pCMV-VSV-G (Addgene #8454) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pBAD expressing fluorescent protein variants (Addgene, UK). Primers used in the assembly of the vectors are listed in SI Table 1.
-
bioRxiv - Biophysics 2022Quote: Fluorescent proteins were obtained from Addgene (https://www.addgene.org/) transfected using 0.2 ug plasmid DNA ...
-
bioRxiv - Physiology 2022Quote: ... EGFP-DCTN1 fusion protein (Addgene pEGFP-p150Glued, #36154) or tdTomato-EB3 fusion protein (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: Plasmid pT7-7 α-Syn A53T for the expression and purification of recombinant α-Syn was a gift from Hilal Lashuel (Addgene plasmid #10572784) and EGFP-α-SynA53T plasmid for α-Syn expression in HEK293T and SH-SY5Y cells was a gift from David Rubinsztein (Addgene plasmid #4082385)).
-
bioRxiv - Cell Biology 2020Quote: ... CMV-R-GECO1 (32) and pDDRFP-A1B1-DEVD (75) were gifted by Robert Campbell (Addgene plasmid #32444 and #36294). pcDNA3-HA-human OCRL (76 ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Bioengineering 2020Quote: ... VPR was amplified by primer pair VPR-F/R (template source: pWalium20-10XUAS-3XFLAG-dCas9-VPR (Addgene No.: # 78897)(Lin et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid used for calcium imaging CMV-mito-R-GECO1 was a gift from Robert Campbell (Addgene plasmid #46021; http://n2t.net/addgene: 46021; RRID: Addgene_46021).
-
bioRxiv - Bioengineering 2021Quote: ... R-GECO expression was done with lipofectamine 3000 using the Addgene plasmid CMV-R-GECO-1.2 at 400 ng per sample (Catalog #45494, Addgene), courtesy of Robert Campbell [26] ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Cancer Biology 2021Quote: ... All the sgRNAs were designed using Benchling Life Sciences R&D Cloud Software (https://benchling.com/) and cloned into the pSpCas9(BB)puroV2.0 vector (Addgene #62988), which expresses both Cas9 and puromycin resistance genes23,24 ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... plasmid pU6-BbsI-chiRNA-dilp8_gRNA1 was generated by cloning the annealed primers #200_DILP8-GuideRNA_1_F “CTTCGCACTGGTTTAGACAGCAGT” and #201_DILP8-GuideRNA_1_R “AAACACTGCTGTCTAAACCAGTGC” into BbsI-digested pU6-BbsI-chiRNA [a gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger (Addgene plasmid # 45946 ...
-
bioRxiv - Cell Biology 2021Quote: ... R-GECO and mito-LAR-GECO were gifts from Robert Campbell (University of Alberta, Addgene plasmid 32444 and 61245) (Wu et al. ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Cell Biology 2019Quote: The human kinome ORF library in pDONOR223 was obtained from Addgene (Cambridge, MA, 1000000014) and cloned into a custom pHAGE-CMV-FLAG destination vector using Gateway cloning technology ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3-HA-human OCRL (76) was supplied by Pietro De Camilli (Addgene plasmid #22207). GFP-C1-PLCdelta-PH (53 ...
-
bioRxiv - Genomics 2020Quote: Human GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene #1000000048) (16) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207 ...