Labshake search
Citations for Addgene :
801 - 850 of 2505 citations for Dickkopf related protein 1 DKK 1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Biochemistry 2023Quote: ... Human codon optimized wild-type Mpro was obtained from Addgene (catalog #141370). Mpro single point mutants (M49A ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Biochemistry 2023Quote: ... Ttyh1 was expressed from a pLX304 vector after addition of C-terminal Strep and His tags to an existing construct (Addgene #161676, a gift from Mike McManus). To stably express fluorescently tagged Prom1 WT and W795R variants in HeLa cells for live cell imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S) (Addgene 29659, a gift from Scott Gradia) using the HiFi Assembly kit (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The p-EGFP plasmid (#6077-1) was purchased from Addgene (Watertown, MA); the pEGFP-TSC2 plasmid was created as previously described in (52 ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV-mDlx-GFP-Fishell-1 (gift from Gordon Fishell; Addgene plasmid # 83900) was used to cut out Dlx enhancer and HBB promoter with MluI and EheI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... MKL-1 Cas9 cell line was developed using pCWCas9 Blast (Addgene #83481) with Blasticidin (10ug/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... HIV-1-GAG fused with EGFP was purchased from Addgene (plasmid 80605). Ezrin plasmid was a generous gift of Adam Kwiatkowski (University of Pittsburgh School of Medicine ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Peter Howley (42) ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1; Addgene plasmid # 8663) were gifts from Dr ...
-
bioRxiv - Biochemistry 2021Quote: ... TRCN0000047920) and cloned into the lentiviral pLKO.1 vector (Addgene, Watertown, MA) as previously described 56 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cell Biology 2021Quote: ... pLVX-GFP-Centrin-1 was a gift from Manuel Thery (Addgene #73331).
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-shmSlug4 was a gift from Bob Weinberg (Addgene plasmid # 40648), pPGS-hSLUG.fl.flag was a gift from Eric Fearon (Addgene plasmid # 25696) ...
-
bioRxiv - Cell Biology 2021Quote: ... pAAV-mDlx-GFP-Fishell-1 was kindly provided by Gordon Fishell (Addgene plasmid #83900 ...
-
bioRxiv - Cell Biology 2021Quote: ... but with a pLKO.1-based vector (gift from Elaine Fuchs, Addgene plasmid # 25999 ...
-
Activation of the Integrated Stress Response overcomes multidrug resistance in FBXW7-deficient cellsbioRxiv - Cancer Biology 2022Quote: ... DLD-1 cells were infected with pCLX-CHOP-dGFP lentiviruses (Addgene, 71299), single cell isolated ...
-
bioRxiv - Microbiology 2022Quote: ... The amplified TaPHB-1 was cloned into pcDNA3-RFP plasmid (#13032, Addgene) using HindIII and NotI restriction sites ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Biophysics 2022Quote: ... The transfer vector consisted of a modified pLKO.1 neo plasmid (Addgene) with expression of the shRNA sequences under control of 3× copies of the lac operator and a copy of the mNeonGreen fluorescence protein ...
-
bioRxiv - Biophysics 2022Quote: ... pGEMHE:mTREK-1(K271Q) was a gift from Dan Minor (Addgene plasmid # 133270) (Lolicato et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene). For sgRNA experiments ...
-
bioRxiv - Biochemistry 2021Quote: The FLAG-HSF-1 plasmid was purchased from Addgene (ID 32537, RRID:Addgene_32537), which was originally established by Dr Stuart Calderwood (40) ...
-
Serotonin Modulates an Inhibitory Input to the Central Amygdala from the Ventral Periaqueductal GraybioRxiv - Neuroscience 2022Quote: ... NC) or AAV9-hSyn-EGFP (diluted 1:10 in sterile PBS, Addgene) was injected bilaterally into the CeA of C57Bl/6J mice ...
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1-Puro was a gift from Bob Weinberg (Addgene plasmid # 8453) (35) ...
-
bioRxiv - Pathology 2020Quote: ... the pLKO.1-puro empty vector was purchased from Addgene (Watertown, MA). A scrambled shRNA control and shRNAs specific for the mouse EZH1 and EZH2 genes were designed by RNAi Central (http://cancan.cshl.edu/RNAi_central/step2.cgi) ...
-
bioRxiv - Cell Biology 2020Quote: ... or GFP-K17ΔNLS cDNA (pEGFP-C3 vector backbone; Addgene REF# 6082-1) were transfected into cells using FuGENE HD Transfection Reagent (Promega REF# E2311 ...
-
bioRxiv - Cell Biology 2019Quote: ... pLKO.1 hygro was a gift from Bob Weinberg (Addgene plasmid # 24150). The maps and the full-length sequences of all the constructs generated in this study are provided in SI2.
-
bioRxiv - Neuroscience 2020Quote: ... or AAV9.hSyn Pr.DIO.hM4Di-mCherry (≥ 1×1013 vg/mL, Addgene # 44362-AAV9). For controls ...
-
bioRxiv - Cancer Biology 2020Quote: ... to 2μg pLKO.1 shRNA plasmid: 1500ng psPAX2 packaging plasmid (Addgene #12260): 500ng pMD2.G envelope plasmid (Addgene #12259 ...
-
bioRxiv - Microbiology 2020Quote: ... pcDNA3 HA eIF4GI (1–1599) was a gift from Nahum Sonenberg (Addgene plasmid #45640 ...
-
bioRxiv - Genomics 2021Quote: ... The Dlx promoter sequence was from pAAV-mDlx-GFP-Fishell-1 (Addgene plasmid #83900 ...
-
bioRxiv - Cell Biology 2021Quote: ... and a pLKO.1 backbone digested with AgeI/EcoRI (Addgene, cat# 26655), respectively ...