Labshake search
Citations for Addgene :
701 - 750 of 2505 citations for Dickkopf related protein 1 DKK 1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: 100 ng of human sgRNA library Brunello in lentiCRISPRv2 (Addgene, #73179) was transformed into electrocompetent Endura cells (#60242 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and HA-tagged human Snai1 (clone 31697) were purchased from Addgene. Full-length cDNA clones for human DDX3X (Accession ...
-
bioRxiv - Immunology 2019Quote: ... Human codon optimized cas9 DNA was obtained from (Addgene, Plasmid #41815). To generate the knockout cell lines ...
-
bioRxiv - Neuroscience 2020Quote: Human pcDNA3.1-CHRNA7-mGFP was a gift from Henry Lester (Addgene plasmid # 62629 ...
-
bioRxiv - Microbiology 2021Quote: ... The lentiviral vector expressing human ACE2 (Dr. Sonja Best, Addgene 154981) was used with the lentiviral packaging plasmid psPAX2 (Dr ...
-
bioRxiv - Immunology 2020Quote: GeCKO and Brunello whole-genome human libraries were acquired from Addgene. Smaller scale validation library was created by selecting the top 300 positive and 50 negative regulators from the Brunello screen and filtering for expression in Ramos cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... and/or the mammalian expression vectors for human HNF4A2 (#31100, Addgene), LXRα (110) ...
-
bioRxiv - Microbiology 2023Quote: ... and Human Interferon-Stimulated Gene CRISPR Knockout pooled Library (#125753, Addgene) (OhAinle et al. ...
-
bioRxiv - Biophysics 2023Quote: Histidine-tagged human RAD52 FL (RAD52 FL) expression vector (pET15b; Addgene) was transformed in E ...
-
bioRxiv - Neuroscience 2023Quote: Human Htt-exon1-Q94 fragment from pTreTight-Htt94Q-CFP (Addgene, #23966) was cloned into pBlueScript SK+ (kind gift of Eva Brinkman ...
-
bioRxiv - Biochemistry 2022Quote: Monomeric EGFP was subcloned into vectors containing human AR (Addgene #29235) and AR-V7 (Addgene #86856 ...
-
bioRxiv - Microbiology 2023Quote: Human TREX1 sequences were derived from plasmid GFP-TREX1 (Addgene 27219) and TREX1-D18N (Addgene 27220).
-
bioRxiv - Cell Biology 2023Quote: Plasmid containing CDS sequences of human MCU were taken from Addgene and restriction digestion was performed ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNA encoding human cGAS (NM_138441.3) was purchased from Addgene (#108674) and subcloned into pEGFP-C3 vector.
-
bioRxiv - Biochemistry 2023Quote: ... The human RTCB gene was inserted into the 438B (Addgene: 30115) plasmid and the 438-Rgfp (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human DNMT1 plasmid was purchased from Addgene (#36939, Watertown, MA, USA) (Li et al. ...
-
bioRxiv - Immunology 2023Quote: Human CD86 C-terminally tagged with enhanced GFP (pCD86-EGFP, Addgene) was sub-cloned into a modified version of the MSCV2.2 retroviral plasmid in which the IRES-GFP cassette was removed ...
-
bioRxiv - Cancer Biology 2023Quote: Human GBM cells were transduced with the 7TGC (Addgene plasmid #24304), 7TGC-SFRP1 or 7TGC-Notum lentiviral vectors at a multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Genetics 2019Quote: ... Cas9 protein and mRNA (44758; Addgene) were co-microinjected into zygotes [F1 hybrids between strains FVB/NJ and B6(Cg)-Tyrc-2J/J] using the reagent concentrations listed in Table S1 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Bioengineering 2021Quote: ... We acquired psPAX2 encoding lentiviral packaging proteins and PMD2.G encoding a lentiviral envelop protein from Addgene (plasmid no ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following ORF24 fragments: residues 1-201 (ORF24-NTD) (Addgene #138420), residues 1-271 (Addgene #138421) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: ... PX458 or PX458 containing gRNA and PLKO.1-puro (Addgene, #10878), were co-transfected into MEFs ...
-
bioRxiv - Biochemistry 2019Quote: The pLKO.1-puro empty vector was purchased from Addgene (#8453). A scrambled shRNA control and gene-specific shRNAs were designed through RNAi Central (http://cancan.cshl.edu/RNAi_central/step2.cgi) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... A pLKO.1-TRC vector (a gift from David Root; Addgene plasmid #10879 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... or negative control annealed oligo was inserted into pLKO.1 (Addgene) (Stewart et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478 ...
-
bioRxiv - Neuroscience 2020Quote: ... and ligated into the pLKO.1 vector (Addgene, 8453 or 26655). Overexpression vectors of either lentiviral (N106 or N174 ...
-
bioRxiv - Systems Biology 2022Quote: pSIRV-AP-1-mCherry was a gift from Peter Steinberger (Addgene plasmid # 118095 ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... pCMV-p38-CA-EGFP and pCMV-eGFP-N1 (Addgene, 6085-1) by using standard Lipofectamine 3000 protocols (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... from Thermo Fisher at a 1:1.5 Lipo:DNA ratio for GFP-Cortactin (Addgene 50728), mEmerald-Talin (Addgene 54266 ...
-
bioRxiv - Cell Biology 2020Quote: Individual sgRNAs (Supplemental Table 1) were cloned into pLentiCRISPRv2 (Addgene #52961) at the BsmBI site as described by the depositor ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
bioRxiv - Neuroscience 2021Quote: were generated using pLKO.1 vector following instructions provided by Addgene. The shRNA sequence was selected using BLOCK-iT™ RNAi Designer provided by Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... SH2 domain sequences were obtained from Addgene (pGEX-SHP-1(NC)-SH2 ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of overnight culture containing pTXB1-Tn5 (Addgene plasmid #60240) was used to inoculate 1 L of ZYM-505 growth media containing 100 μg/mL ampicillin and 0.001% polypropylene glycol (L14699-AE ...
-
bioRxiv - Biochemistry 2022Quote: DNA constructs for the expression of KRAS4B (1-169) (Addgene #159539) and RAF1 (52-131 ...
-
bioRxiv - Neuroscience 2022Quote: ... for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene, plasmid #100834-AAV1) for calcium imaging were administered directly into the hippocampus ...
-
bioRxiv - Microbiology 2022Quote: ... HIV-1 GagPol was expressed by pCMV ΔR8.2 (Addgene plasmid # 12263). The protease mutations D25N and R57G were generated by overlapping PCR using pCMV ΔR8.2 as a template ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...