Labshake search
Citations for Addgene :
801 - 850 of 1387 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... and guide cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D and sequenced to ensure authenticity before transferring to Agrobacterium.
-
bioRxiv - Cancer Biology 2023Quote: The sgRNAs specific for 5’ to the region of interest were cloned in pLentiCRISPRv2 (Addgene, #52961). sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Molecular Biology 2023Quote: ... Three clones with the correct insertion were transiently transfected with either 5 μg pFlpO (Addgene #13793) to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792 ...
-
bioRxiv - Neuroscience 2024Quote: USP14_Reverse: 5’ AAACCCAATGGTATTCAAGGCTCACC 3’ were cloned into pSpCas9(BB)-2A-Puro vector (PX459, 62988, Addgene, USA) using FastDigest BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... The sgRNA target sequence: 5’-GCCGGCGAGCACTTTTATTG was cloned into the pU6-BbsI-chiRNA vector (Addgene, #45946). The vector for HDR contains the 5’ homology arm containing Shv genomic region (1000 base pairs at the 3’ end of the Shv gene with the stop codon removed ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 × 106 cells were co-transfected with 5 µg of eSpCas9-hGeminin plasmid (Addgene plasmid, #86613) and 5 ug of ATP1A1_plasmid_donor_RD (Addgene plasmid ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... male mice first received bilateral injections of virus (AAV2/5-ef1α-FLEX-taCasp3-TEVp, Addgene, 45580) into the caudolateral PAG (day 0) ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles containing the sgRNA against mouse Rap1 (target: 5’-GCAGTCTAGGATGTACTGCG-3’) in lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2024Quote: Full-length human CEP152 with gRNA resistance (5’-CAGAACAGTTAGAAATGAGT-3’) in pAID 1.1C-T2A-Bsr (Addgene) and CEP152D43/44A in pEGFP-C1 were synthesized by GenScript ...
-
bioRxiv - Cell Biology 2024Quote: ... reverse primer: 5’-ATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC-3’) and cloned into pLentiCRISPRv2-Opti (a gift from David Sabatini; Addgene plasmid # 163126 ...
-
bioRxiv - Cancer Biology 2024Quote: ... AAV2 rep genes and adenovirus serotype 5 helper genes (gift from David Russell - Addgene plasmid #110660).62 Particles were harvested after 72 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 million cells per replicate were activated and 12-20 h later electroporated with the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene 48138) expressing the Myc sgRNA using the MaxCyte STx transfection system (MaxCyte) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Casper strains were available and 20 ng/μL DNA plasmids encoding mNG-GECO1 under the control of nuclear-localized elavl3/HuC promoter (Addgene: 59530) were injected into two-cell stage embryos of Casper mutant zebrafish33 with 40 ng/μl Tol2 transposase mRNA (26 ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 pmol of the oligo mix was added to a 20 μl Golden Gate reaction containing 100 ng destination plasmid (pATT-DEST, Addgene #79770), 10 units BsaI (NEB #R3733) ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA (100 ng/μl) and SEC repair template (20 ng/μl) plasmids combined with Peft-3::Cas9 (60 ng/μl; Addgene #46168) and Pmyo-2::mCherry co-injection marker (2.5 ng/μl ...
-
bioRxiv - Immunology 2020Quote: ... antisense: aaacCAGTGATGTCACCCGTGTGC) were hybridised and ligated into the Bsm BI site of pLentiGuide-Puro (gift from Feng Zhang, Addgene # 52963 (20)) ...
-
bioRxiv - Neuroscience 2022Quote: ... we selected a 20-bp gRNA target sequence that flanked the stop codon and cloned it into pU6-BbsI-chiRNA (Addgene #45946). If the gRNA sequence did not flank the stop codon ...
-
bioRxiv - Genetics 2024Quote: A CRIPSR guide for the SCN5A E171Q mutation was designed using the CRISPOR online tool.20 We cloned the guide sequence (AATCTTGACCAGAGACTCAA-AGG) into SpCas9-2A-GFP (pX458, Addgene #48138)21 by annealing complementary primers 5’CACCGAATCTTGACCAGAGACTCAA and 5’AAACTTGAGTCTCTGGTCAAGATTC ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded at 20% confluence and infected with lentivirus generated from pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang (41)) engineered to deliver Cas9 and a gRNA targeting LMAN1 (CCCCTTACACTATAGTGACG) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cas9-mRNA was in vitro transcribed overnight at 20°C from 400-500 ng XbaI-linearized pT3TS-nCas9n (Addgene, plasmid #46757) using the mMessage mMachine T3 Kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... along with the appropriate BsmBI recognition sequences (CGTCTCACACCG (sgRNA, 20 nt) GTTTCGAGACG) were added for cloning into the lentiCRISPRv2 (Addgene, #52961) sgRNA and spCas9 expression system ...
-
bioRxiv - Cell Biology 2023Quote: ... NPY-pHluorin (A kind gift from Sebastian Barg, Uppsala), Synaptophysin-pHTomato (A kind gift from Yulong Li lab, China) and mCherry-Lysosomes-20 (Addgene, 55073). Cells were cultured in G418 containing media for 14 days for stable cell line generation.
-
bioRxiv - Genetics 2023Quote: ... and VP64 were individually cloned as fusions to rTetR(SE-G72P)20 using the backbone from pJT126 lenti pEF-rTetR(SE-G72P)-3XFLAG-LibCloneSite-T2A-mCherry-BSD-WPRE (Addgene #161926) digested with Esp3I-HF ...
-
bioRxiv - Synthetic Biology 2024Quote: ... with library plasmid amount corresponding to 1 plasmid per cell and 20 ug of base editor pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978) (Addgene #185910). Genomic DNA was collected from cells 5 days after transfection.
-
bioRxiv - Cell Biology 2020Quote: ... pLenti [CM V/GFP/Hygro] (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17446). The cut backbone vector was treated with Antarctic Phosphatase (cat# M0289S ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446; http://n2t.net/addgene:17446; RRID:Addgene_17446)65 ...
-
bioRxiv - Biochemistry 2022Quote: HEK293T cells were transiently transfected with pGP-CMV-GcAMP6s (Ca2+ Sensor plasmid, Addgene, Cat. no. 40753; 4 µg), 5HT2c receptor (as positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and subcloned into pLenti-CMV-GFP-Hygro (656-4) (gifted from Eric Campeau & Paul Kaufman; Addgene plasmid # 17446) using NEBuilder® HiFi DNA Assembly Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: The genome-wide Brie CRISPR-KO library (4 sgRNAs per gene; ~ 80.000 sgRNAs) was purchased from Addgene (#73632) and amplified according to the supplier’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection was performed with control vector (pcDNA/GW-40/LacZ) or 4 μg pARID1A (Addgene catalogue number 39311) using FuGENE 6 Transfection Reagent (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... Electrocompetent BW25113 cells were co-transformed with the pORTMAGE-4 plasmid (Addgene plasmid #72679, courtesy of Csaba Pál) and the pBAD-yTrm5 plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4×105 HEK 293T cells were transfected with pCDH-EF1-sCTLA-4 expression plasmid (1.5 µg) and psPax2 (2 µg) and pMD2.G (1.5 µg) packaging plasmids (Addgene), using Viafect™ (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259), 10 µg of psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Neuroscience 2024Quote: ... groups of 3-4 pups were separated from their mother and 6 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3.1-GFP(1-10) was a gift from Bo Huang (Addgene plasmid # 70219). 2PH-PLCdelta-GFP was a gift from Sergio Grinstein (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cells were co-electroporated with 10 μg pCBA-SceI (Addgene, plasmid #26477) (44 ...
-
bioRxiv - Immunology 2021Quote: ... mApple-CD36-C-10 was a gift from Michael Davidson (Addgene plasmid # 54874). The pET23a vector ...
-
bioRxiv - Biophysics 2021Quote: ... was a gift from Michael Davidson (mApple-MAPTau-N-10, Addgene plasmid # 54925). Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.1×10^13 g.c./mL AAV9-hSyn-DIO-hM4D(Gi)-mCherry from Addgene, 2.1×10^13 g.c./mL AAV9-hSyn-DIO-hM3D(Gq)-mCherry from Addgene ...
-
bioRxiv - Cell Biology 2020Quote: mRuby2-MannII-N-10 was a gift from Michael Davidson (Addgene plasmid # 55903)(83) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV8-hSyn-DIO-hM3Dq-mCherry virus (Addgene, Plasmid #50475, titer 1.9×10^13). was injected into LH Leptin receptor-expressing (LepR ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected AAV5-CAG-FLEX-ArchT-tdTomato (titer 10^13 gc/mL, Addgene) in the DLS ...
-
bioRxiv - Microbiology 2020Quote: ... pQCXIP-BSR-GFP11 and pQCXIP-GFP1-10 were from Yutaka Hata 51 (Addgene plasmid #68716 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-hSyn-DIO-mCherry (#50459, Addgene, 4.8 x 10^12 GC/mL titer) and AAV5-Ef1a-DIO-hChR2(C128S/D156A)-EYFP (4.9×10^12 titer ...
-
bioRxiv - Cell Biology 2021Quote: ... pSJ1256 (pFA6a-link-yGFP1-10-CaURA3MX) was a gift from Sue Jaspersen (Addgene plasmid # 86419 ...