Labshake search
Citations for Addgene :
751 - 800 of 1387 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... annealed oligos were diluted 1:20 in molecular grade H2O and then ligated into Esp3I-digested pLentiCRISPR V2.0 (Addgene #52961). Ligation reactions were then transformed into Top10 competent E ...
-
bioRxiv - Cell Biology 2023Quote: ... Mito-mTagBFP2 was cloned by replacing EGFP in mito-EGFP with mTagBFP2 sequence in pcDNA3.1 from mTagBFP2-Lysosome-20 (Addgene #55308). KIF5C(1-560)-2xmCh-EF(C ...
-
bioRxiv - Genomics 2023Quote: Pairs of gRNA plasmids were constructed by inserting a 20 bp target sequence (Supplementary Table S25) into an empty gRNA cloning vector (a gift from George Church; Addgene plasmid # 41824 ...
-
bioRxiv - Neuroscience 2024Quote: ... A pulled glass pipette tip of 20–30 μm containing CTB647 (ThermoFischer Scientific, C34778) or retrograde AAV (Addgene, AAV-PHP.eB) and FG was lowered into the brain ...
-
bioRxiv - Neuroscience 2023Quote: ... we inserted a barcode sequence consisting of 20 random nucleotides in the 3’ untranslated region of the nucleoprotein gene in pRVΔG-4mCherry (Addgene #52488) (SAD B19 strain ...
-
bioRxiv - Cell Biology 2024Quote: Viral supernatants were produced by co-transfecting HEK293T cells at 70-80% confluency in a T175 flask with 20 μg pHIV-Luc-ZsGreen (gift from Bryan Welm (Addgene plasmid #39196 ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Microbiology 2021Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17446) (Campeau et al. ...
-
bioRxiv - Genetics 2021Quote: The Drosophila CRISPR genome-wide knockout library was previously described and is available from Addgene (134582-4)20,55 ...
-
bioRxiv - Neuroscience 2024Quote: ... was injected with a mixture of Cre-expressing and Cre-dependent adeno-associated viral vectors carrying the genes for ChR2 and tdTomato (AAV9.CamKII.4.Cre.SV40 and AAV9.CAG.Flex.ChR2.tdTomato, Addgene). Following a post-injection survival period of 9 weeks ...
-
bioRxiv - Cell Biology 2023Quote: Linear tetra-ubiquitin fused to GST (GST-4×Ub) was cloned into a pGEX-4T1 vector (RRID:Addgene_199779). After the transformation of the pGEX-4T1 vector encoding GST-4×Ub in E ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lenti dCAS-VP64_Blast (4) was a gift from Feng Zhang (Addgene plasmid # 61425; http://n2t.net/addgene:61425; RRID:Addgene_61425). lenti MS2-P65-HSF1_Hygro (4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... lenti MS2-P65-HSF1_Hygro (4) was a gift from Feng Zhang (Addgene plasmid # 61426; http://n2t.net/addgene:61426; RRID:Addgene_61426). lentiMPH v2 (20 ...
-
bioRxiv - Cell Biology 2024Quote: ... a total of 3.65 μg DNA vectors including 0.47 μg pCE-hOCT3/4 (Addgene, MA, U.S.A, #41813), 0.47 μg pCE-hSK (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 week-old male p62 fl/fl mice were transduced with pAAV.TBG.PI.eGFP.WPRE.bGH (AAV8) (Addgene item #105535-AAV8) or AAV.TBG.PI.Cre.rBG (AAV8 ...
-
bioRxiv - Developmental Biology 2024Quote: ... unc-4 and vab-7 homology arms were cloned into the mNG-SEC plasmid pDD268 (Addgene #132523). Primers are listed in Supplemental Table S1.
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-LaminB1-10 was a gift from Michael Davidson (Addgene plasmid # 55069), pAAV_hsyn_NES-his-CAMPARI2-F391W-WPRE-SV40 was a gift from Eric Schreiter (Addgene plasmid # 101061)31 ...
-
Serotonin Modulates an Inhibitory Input to the Central Amygdala from the Ventral Periaqueductal GraybioRxiv - Neuroscience 2022Quote: ... NC) or AAV9-hSyn-EGFP (diluted 1:10 in sterile PBS, Addgene) was injected bilaterally into the CeA of C57Bl/6J mice ...
-
bioRxiv - Neuroscience 2021Quote: ... including AAV5-hSyn-DIO-hM4DGi-mCherry (#44362, Addgene, 1.2x 10^13 titer), AAV5-hSyn-DIO-mCherry (#50459 ...
-
bioRxiv - Immunology 2020Quote: mAmetrine-LaminB1-10 was a gift from Michael Davidson (Addgene plasmid # 56547); pTRIP-CMV-tagRFP-FLAG-cGAS was a gift from Nicolas Manel (Addgene plasmid # 86676) ...
-
bioRxiv - Microbiology 2020Quote: ... The eBFP2.LMNB1 gene was amplified from pEBFP2-LaminB1-10 (Addgene #55244) and transferred via Gibson assembly into PmeI/BamHI linearized pWPI IRES BLR (Trotard et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... using intraplantar injections of 10 µl of AAV9.CAG.Flex.GCaMP6s.WPRE.SV40 (Addgene, 100842-AAV9) into newborn MrgprD-Cre+ mice ...
-
bioRxiv - Microbiology 2022Quote: ... we amplified the 24xms2 cassette from pCR4-24xMS2SL-stable (Addgene #31865 (10)) such that the 5’ BamHI site of the 24xms2 cassette was removed and additional restriction sites were added at the 3’ end ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1_hSyn1-SIO-stGtACR2-FusionRed (Addgene 105677, 2.1e+12 after 10 fold dilution) was used for optogenetic inactivation ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-Syn-Flex-GCaMP6m-WPRE-SV40 (1×10¹³ vg/ml, Addgene 100838).
-
bioRxiv - Neuroscience 2022Quote: ... 26 or AAV5-hSyn-DIO-mCherry (2.3 × 10^13 GC/ml; Addgene) was bilaterally injected into either the mPFC (AP:1.7 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-10:LMNB1-mEGFP (Addgene plasmid #87422; http://n2t.net/addgene:87422; RRID:Addgene_87422), AICSDP-52 ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Molecular Biology 2021Quote: ... an XhoI restriction site was generated 5’ of the GFP-gene in pDRGFP (Addgene plasmid #26475)23 and the GFP-gene was replaced by the eBFP1.2 gene using the XhoI/NotI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... and guide cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D and sequenced to ensure authenticity before transferring to Agrobacterium.
-
bioRxiv - Molecular Biology 2023Quote: ... Three clones with the correct insertion were transiently transfected with either 5 μg pFlpO (Addgene #13793) to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792 ...
-
bioRxiv - Neuroscience 2023Quote: ... or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).